Incidental Mutation 'R8442:Kif18a'
ID654237
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8442 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109294973 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 245 (I245T)
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028527
AA Change: I245T

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115
AA Change: I245T

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apof T C 10: 128,269,022 L15P probably damaging Het
BC048671 T C 6: 90,305,113 F84S probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C2cd4a C T 9: 67,831,757 M1I probably null Het
Cd72 T A 4: 43,450,109 K266N possibly damaging Het
Col12a1 A G 9: 79,635,499 F2328S probably damaging Het
Cubn T C 2: 13,314,044 Y2948C probably damaging Het
Dagla A G 19: 10,263,092 probably null Het
Dagla A G 19: 10,271,519 F24L probably damaging Het
Dnah14 A G 1: 181,741,284 T2860A probably damaging Het
Efcab2 A T 1: 178,437,436 K22N probably benign Het
Flt1 C T 5: 147,576,173 R1118Q probably damaging Het
Foxl1 T A 8: 121,128,485 L175Q possibly damaging Het
Gm572 G T 4: 148,658,993 R140L possibly damaging Het
Gucy2g T C 19: 55,217,401 R676G probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hspb8 T C 5: 116,422,445 Y12C probably damaging Het
Igf2bp2 A C 16: 22,065,091 probably null Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Il5 C T 11: 53,721,824 P54S probably damaging Het
Kif2b T A 11: 91,576,314 N381I possibly damaging Het
Lrrc49 A G 9: 60,593,625 F679S probably benign Het
Med24 A G 11: 98,707,557 F742L probably benign Het
Msh3 T C 13: 92,212,512 T1071A probably benign Het
Neb T C 2: 52,287,208 T1374A probably damaging Het
Olfr1428 A T 19: 12,108,727 I47N probably damaging Het
Olfr501-ps1 A C 7: 108,508,644 Q196P unknown Het
P3h2 A G 16: 25,987,205 I296T probably benign Het
Pcdhb21 A T 18: 37,513,788 probably benign Het
Prkab2 G T 3: 97,658,686 G25C probably damaging Het
Ptprm C A 17: 66,944,317 A522S possibly damaging Het
Scarf2 A G 16: 17,806,367 D512G probably benign Het
Sema3d A G 5: 12,542,641 T346A probably damaging Het
Sept7 T C 9: 25,252,642 S2P unknown Het
Sfrp5 A G 19: 42,198,797 V278A probably benign Het
Taar1 T A 10: 23,920,624 C73* probably null Het
Tek T A 4: 94,827,685 L448Q probably benign Het
Tmem132a A C 19: 10,858,469 L899R probably damaging Het
Txndc5 T C 13: 38,527,869 probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Uggt1 A G 1: 36,173,487 S925P probably damaging Het
Unc13d A T 11: 116,067,831 D786E probably damaging Het
Vmn1r26 T C 6: 58,008,743 T154A possibly damaging Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2141:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3882:Kif18a UTSW 2 109306974 missense probably benign 0.01
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R4819:Kif18a UTSW 2 109292126 missense probably damaging 1.00
R5078:Kif18a UTSW 2 109295142 splice site probably benign
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R6886:Kif18a UTSW 2 109296663 missense probably damaging 1.00
R7069:Kif18a UTSW 2 109295002 missense probably damaging 0.99
R7765:Kif18a UTSW 2 109306940 missense probably benign 0.00
R7801:Kif18a UTSW 2 109287845 missense probably damaging 0.99
R7834:Kif18a UTSW 2 109296774 missense probably damaging 1.00
R8510:Kif18a UTSW 2 109296764 missense probably damaging 1.00
Z1176:Kif18a UTSW 2 109318053 missense possibly damaging 0.63
Z1177:Kif18a UTSW 2 109294957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTTGGGACAGCCTTTAATATC -3'
(R):5'- ACATATGGGACGCACCTTTG -3'

Sequencing Primer
(F):5'- GGGACAGCCTTTAATATCAAAACTC -3'
(R):5'- ACGCACCTTTGTATTTGCTAAGG -3'
Posted On2020-10-20