Incidental Mutation 'R8442:Kif2b'
ID654258
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Namekinesin family member 2B
Synonyms1700063D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R8442 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location91575315-91577558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91576314 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 381 (N381I)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061019
AA Change: N381I

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: N381I

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apof T C 10: 128,269,022 L15P probably damaging Het
BC048671 T C 6: 90,305,113 F84S probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C2cd4a C T 9: 67,831,757 M1I probably null Het
Cd72 T A 4: 43,450,109 K266N possibly damaging Het
Col12a1 A G 9: 79,635,499 F2328S probably damaging Het
Cubn T C 2: 13,314,044 Y2948C probably damaging Het
Dagla A G 19: 10,263,092 probably null Het
Dagla A G 19: 10,271,519 F24L probably damaging Het
Dnah14 A G 1: 181,741,284 T2860A probably damaging Het
Efcab2 A T 1: 178,437,436 K22N probably benign Het
Flt1 C T 5: 147,576,173 R1118Q probably damaging Het
Foxl1 T A 8: 121,128,485 L175Q possibly damaging Het
Gm572 G T 4: 148,658,993 R140L possibly damaging Het
Gucy2g T C 19: 55,217,401 R676G probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hspb8 T C 5: 116,422,445 Y12C probably damaging Het
Igf2bp2 A C 16: 22,065,091 probably null Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Il5 C T 11: 53,721,824 P54S probably damaging Het
Kif18a T C 2: 109,294,973 I245T possibly damaging Het
Lrrc49 A G 9: 60,593,625 F679S probably benign Het
Med24 A G 11: 98,707,557 F742L probably benign Het
Msh3 T C 13: 92,212,512 T1071A probably benign Het
Neb T C 2: 52,287,208 T1374A probably damaging Het
Olfr1428 A T 19: 12,108,727 I47N probably damaging Het
Olfr501-ps1 A C 7: 108,508,644 Q196P unknown Het
P3h2 A G 16: 25,987,205 I296T probably benign Het
Pcdhb21 A T 18: 37,513,788 probably benign Het
Prkab2 G T 3: 97,658,686 G25C probably damaging Het
Ptprm C A 17: 66,944,317 A522S possibly damaging Het
Scarf2 A G 16: 17,806,367 D512G probably benign Het
Sema3d A G 5: 12,542,641 T346A probably damaging Het
Sept7 T C 9: 25,252,642 S2P unknown Het
Sfrp5 A G 19: 42,198,797 V278A probably benign Het
Taar1 T A 10: 23,920,624 C73* probably null Het
Tek T A 4: 94,827,685 L448Q probably benign Het
Tmem132a A C 19: 10,858,469 L899R probably damaging Het
Txndc5 T C 13: 38,527,869 probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Uggt1 A G 1: 36,173,487 S925P probably damaging Het
Unc13d A T 11: 116,067,831 D786E probably damaging Het
Vmn1r26 T C 6: 58,008,743 T154A possibly damaging Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91576380 missense probably damaging 1.00
IGL01459:Kif2b APN 11 91577023 missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91576365 missense probably damaging 1.00
IGL02897:Kif2b APN 11 91576219 missense probably damaging 1.00
R0076:Kif2b UTSW 11 91575909 missense probably damaging 1.00
R0488:Kif2b UTSW 11 91576972 missense probably benign 0.00
R0524:Kif2b UTSW 11 91575724 missense probably benign 0.00
R0549:Kif2b UTSW 11 91576584 missense probably damaging 1.00
R0893:Kif2b UTSW 11 91575594 missense probably benign 0.16
R1677:Kif2b UTSW 11 91575972 missense probably damaging 1.00
R2025:Kif2b UTSW 11 91577346 missense probably damaging 0.99
R2185:Kif2b UTSW 11 91576971 frame shift probably null
R2290:Kif2b UTSW 11 91575696 missense probably benign 0.00
R4697:Kif2b UTSW 11 91576846 missense probably benign 0.01
R4785:Kif2b UTSW 11 91576428 missense probably benign 0.07
R5429:Kif2b UTSW 11 91577229 missense probably benign 0.03
R5555:Kif2b UTSW 11 91575460 missense probably benign 0.00
R5652:Kif2b UTSW 11 91575830 missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91577242 missense probably benign 0.28
R6101:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6105:Kif2b UTSW 11 91575988 missense probably benign 0.00
R6450:Kif2b UTSW 11 91576366 missense probably damaging 0.99
R6862:Kif2b UTSW 11 91575915 missense probably damaging 1.00
R7097:Kif2b UTSW 11 91576824 missense probably benign 0.00
R7189:Kif2b UTSW 11 91577137 missense probably benign 0.01
R7507:Kif2b UTSW 11 91577443 missense probably benign
R7742:Kif2b UTSW 11 91576585 missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91576126 missense probably damaging 1.00
R7820:Kif2b UTSW 11 91577274 missense probably benign 0.01
R7946:Kif2b UTSW 11 91575745 missense probably benign 0.00
R8378:Kif2b UTSW 11 91576375 missense possibly damaging 0.95
R8925:Kif2b UTSW 11 91577197 missense probably benign 0.00
R8927:Kif2b UTSW 11 91577197 missense probably benign 0.00
Z1176:Kif2b UTSW 11 91576264 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCCCAGCTAAGTCAACCAG -3'
(R):5'- AGGAAAGGCCCAAGATTGTTC -3'

Sequencing Primer
(F):5'- GAAAACTTGCCGTGCAGCTTC -3'
(R):5'- GCCCAAGATTGTTCTAAAGGC -3'
Posted On2020-10-20