Mutagenetix > Incidental Mutation

Incidental Mutation 'R8442:P3h2'

654265

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8442 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25987205 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 296 (I296T)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

probably benign
Transcript: ENSMUST00000039990
AA Change: I296T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: I296T

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apof	T	C	10: 128,269,022	L15P	probably damaging	Het
BC048671	T	C	6: 90,305,113	F84S	probably benign	Het
Bsn	G	A	9: 108,111,452	A2367V	probably benign	Het
C2cd4a	C	T	9: 67,831,757	M1I	probably null	Het
Cd72	T	A	4: 43,450,109	K266N	possibly damaging	Het
Col12a1	A	G	9: 79,635,499	F2328S	probably damaging	Het
Cubn	T	C	2: 13,314,044	Y2948C	probably damaging	Het
Dagla	A	G	19: 10,263,092		probably null	Het
Dagla	A	G	19: 10,271,519	F24L	probably damaging	Het
Dnah14	A	G	1: 181,741,284	T2860A	probably damaging	Het
Efcab2	A	T	1: 178,437,436	K22N	probably benign	Het
Flt1	C	T	5: 147,576,173	R1118Q	probably damaging	Het
Foxl1	T	A	8: 121,128,485	L175Q	possibly damaging	Het
Gm572	G	T	4: 148,658,993	R140L	possibly damaging	Het
Gucy2g	T	C	19: 55,217,401	R676G	probably benign	Het
Hmcn2	C	A	2: 31,391,076	L1867I	probably benign	Het
Hspb8	T	C	5: 116,422,445	Y12C	probably damaging	Het
Igf2bp2	A	C	16: 22,065,091		probably null	Het
Igkv9-129	T	A	6: 67,839,800	M3K	probably damaging	Het
Il5	C	T	11: 53,721,824	P54S	probably damaging	Het
Kif18a	T	C	2: 109,294,973	I245T	possibly damaging	Het
Kif2b	T	A	11: 91,576,314	N381I	possibly damaging	Het
Lrrc49	A	G	9: 60,593,625	F679S	probably benign	Het
Med24	A	G	11: 98,707,557	F742L	probably benign	Het
Msh3	T	C	13: 92,212,512	T1071A	probably benign	Het
Neb	T	C	2: 52,287,208	T1374A	probably damaging	Het
Olfr1428	A	T	19: 12,108,727	I47N	probably damaging	Het
Olfr501-ps1	A	C	7: 108,508,644	Q196P	unknown	Het
Pcdhb21	A	T	18: 37,513,788		probably benign	Het
Prkab2	G	T	3: 97,658,686	G25C	probably damaging	Het
Ptprm	C	A	17: 66,944,317	A522S	possibly damaging	Het
Scarf2	A	G	16: 17,806,367	D512G	probably benign	Het
Sema3d	A	G	5: 12,542,641	T346A	probably damaging	Het
Sept7	T	C	9: 25,252,642	S2P	unknown	Het
Sfrp5	A	G	19: 42,198,797	V278A	probably benign	Het
Taar1	T	A	10: 23,920,624	C73*	probably null	Het
Tek	T	A	4: 94,827,685	L448Q	probably benign	Het
Tmem132a	A	C	19: 10,858,469	L899R	probably damaging	Het
Txndc5	T	C	13: 38,527,869		probably benign	Het
Uck1	C	A	2: 32,260,141		probably benign	Het
Uggt1	A	G	1: 36,173,487	S925P	probably damaging	Het
Unc13d	A	T	11: 116,067,831	D786E	probably damaging	Het
Vmn1r26	T	C	6: 58,008,743	T154A	possibly damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCATAAGCCTGTGTTGC -3'
(R):5'- AATGATGTCACTGTCTGTATGAGG -3'

Sequencing Primer
(F):5'- CTTTGGTGATGAAAGCAAGCAG -3'
(R):5'- TCATGGTTGGAGATGTTAAGACAG -3'

Posted On

2020-10-20