Incidental Mutation 'R8442:Sfrp5'
ID654272
Institutional Source Beutler Lab
Gene Symbol Sfrp5
Ensembl Gene ENSMUSG00000018822
Gene Namesecreted frizzled-related sequence protein 5
SynonymsSARP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8442 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location42197971-42202252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42198797 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 278 (V278A)
Ref Sequence ENSEMBL: ENSMUSP00000018966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018966] [ENSMUST00000169536]
Predicted Effect probably benign
Transcript: ENSMUST00000018966
AA Change: V278A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000018966
Gene: ENSMUSG00000018822
AA Change: V278A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FRI 49 164 6.28e-58 SMART
C345C 191 294 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169536
SMART Domains Protein: ENSMUSP00000130684
Gene: ENSMUSG00000018820

DomainStartEndE-ValueType
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
transmembrane domain 190 212 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
FYVE 342 415 2.52e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Secreted frizzled-related protein 5 (SFRP5) is a member of the SFRP family that contains a cysteine-rich domain homologous to the putative Wnt-binding site of Frizzled proteins. SFRPs act as soluble modulators of Wnt signaling. SFRP5 and SFRP1 may be involved in determining the polarity of photoreceptor cells in the retina. SFRP5 is highly expressed in the retinal pigment epithelium, and moderately expressed in the pancreas. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apof T C 10: 128,269,022 L15P probably damaging Het
BC048671 T C 6: 90,305,113 F84S probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C2cd4a C T 9: 67,831,757 M1I probably null Het
Cd72 T A 4: 43,450,109 K266N possibly damaging Het
Col12a1 A G 9: 79,635,499 F2328S probably damaging Het
Cubn T C 2: 13,314,044 Y2948C probably damaging Het
Dagla A G 19: 10,263,092 probably null Het
Dagla A G 19: 10,271,519 F24L probably damaging Het
Dnah14 A G 1: 181,741,284 T2860A probably damaging Het
Efcab2 A T 1: 178,437,436 K22N probably benign Het
Flt1 C T 5: 147,576,173 R1118Q probably damaging Het
Foxl1 T A 8: 121,128,485 L175Q possibly damaging Het
Gm572 G T 4: 148,658,993 R140L possibly damaging Het
Gucy2g T C 19: 55,217,401 R676G probably benign Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hspb8 T C 5: 116,422,445 Y12C probably damaging Het
Igf2bp2 A C 16: 22,065,091 probably null Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Il5 C T 11: 53,721,824 P54S probably damaging Het
Kif18a T C 2: 109,294,973 I245T possibly damaging Het
Kif2b T A 11: 91,576,314 N381I possibly damaging Het
Lrrc49 A G 9: 60,593,625 F679S probably benign Het
Med24 A G 11: 98,707,557 F742L probably benign Het
Msh3 T C 13: 92,212,512 T1071A probably benign Het
Neb T C 2: 52,287,208 T1374A probably damaging Het
Olfr1428 A T 19: 12,108,727 I47N probably damaging Het
Olfr501-ps1 A C 7: 108,508,644 Q196P unknown Het
P3h2 A G 16: 25,987,205 I296T probably benign Het
Pcdhb21 A T 18: 37,513,788 probably benign Het
Prkab2 G T 3: 97,658,686 G25C probably damaging Het
Ptprm C A 17: 66,944,317 A522S possibly damaging Het
Scarf2 A G 16: 17,806,367 D512G probably benign Het
Sema3d A G 5: 12,542,641 T346A probably damaging Het
Sept7 T C 9: 25,252,642 S2P unknown Het
Taar1 T A 10: 23,920,624 C73* probably null Het
Tek T A 4: 94,827,685 L448Q probably benign Het
Tmem132a A C 19: 10,858,469 L899R probably damaging Het
Txndc5 T C 13: 38,527,869 probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Uggt1 A G 1: 36,173,487 S925P probably damaging Het
Unc13d A T 11: 116,067,831 D786E probably damaging Het
Vmn1r26 T C 6: 58,008,743 T154A possibly damaging Het
Other mutations in Sfrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Sfrp5 APN 19 42199029 missense probably benign 0.00
IGL03347:Sfrp5 APN 19 42198768 missense probably benign 0.00
R1686:Sfrp5 UTSW 19 42201704 missense possibly damaging 0.88
R1911:Sfrp5 UTSW 19 42198798 missense probably benign
R2005:Sfrp5 UTSW 19 42198836 missense probably benign 0.03
R3815:Sfrp5 UTSW 19 42198791 missense probably benign 0.06
R3930:Sfrp5 UTSW 19 42201818 missense probably damaging 1.00
R5829:Sfrp5 UTSW 19 42201656 missense probably damaging 1.00
R5980:Sfrp5 UTSW 19 42201972 missense unknown
R6351:Sfrp5 UTSW 19 42201824 missense possibly damaging 0.91
R6702:Sfrp5 UTSW 19 42201827 missense probably benign 0.02
R6764:Sfrp5 UTSW 19 42199799 missense probably benign 0.00
R6836:Sfrp5 UTSW 19 42201710 missense probably damaging 0.97
R6895:Sfrp5 UTSW 19 42199788 missense probably damaging 1.00
R7024:Sfrp5 UTSW 19 42201765 missense possibly damaging 0.56
R7543:Sfrp5 UTSW 19 42198863 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTTTGGAGCCTGTGCAGTAG -3'
(R):5'- ACCGAAAGTTGATTGGAGCC -3'

Sequencing Primer
(F):5'- TGAAGCCATCCTTGGGGG -3'
(R):5'- AGTTGATTGGAGCCCAGAAG -3'
Posted On2020-10-20