Incidental Mutation 'R8442:Gucy2g'
ID654273
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8442 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55217401 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 676 (R676G)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably benign
Transcript: ENSMUST00000069183
AA Change: R676G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: R676G

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apof T C 10: 128,269,022 L15P probably damaging Het
BC048671 T C 6: 90,305,113 F84S probably benign Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C2cd4a C T 9: 67,831,757 M1I probably null Het
Cd72 T A 4: 43,450,109 K266N possibly damaging Het
Col12a1 A G 9: 79,635,499 F2328S probably damaging Het
Cubn T C 2: 13,314,044 Y2948C probably damaging Het
Dagla A G 19: 10,263,092 probably null Het
Dagla A G 19: 10,271,519 F24L probably damaging Het
Dnah14 A G 1: 181,741,284 T2860A probably damaging Het
Efcab2 A T 1: 178,437,436 K22N probably benign Het
Flt1 C T 5: 147,576,173 R1118Q probably damaging Het
Foxl1 T A 8: 121,128,485 L175Q possibly damaging Het
Gm572 G T 4: 148,658,993 R140L possibly damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hspb8 T C 5: 116,422,445 Y12C probably damaging Het
Igf2bp2 A C 16: 22,065,091 probably null Het
Igkv9-129 T A 6: 67,839,800 M3K probably damaging Het
Il5 C T 11: 53,721,824 P54S probably damaging Het
Kif18a T C 2: 109,294,973 I245T possibly damaging Het
Kif2b T A 11: 91,576,314 N381I possibly damaging Het
Lrrc49 A G 9: 60,593,625 F679S probably benign Het
Med24 A G 11: 98,707,557 F742L probably benign Het
Msh3 T C 13: 92,212,512 T1071A probably benign Het
Neb T C 2: 52,287,208 T1374A probably damaging Het
Olfr1428 A T 19: 12,108,727 I47N probably damaging Het
Olfr501-ps1 A C 7: 108,508,644 Q196P unknown Het
P3h2 A G 16: 25,987,205 I296T probably benign Het
Pcdhb21 A T 18: 37,513,788 probably benign Het
Prkab2 G T 3: 97,658,686 G25C probably damaging Het
Ptprm C A 17: 66,944,317 A522S possibly damaging Het
Scarf2 A G 16: 17,806,367 D512G probably benign Het
Sema3d A G 5: 12,542,641 T346A probably damaging Het
Sept7 T C 9: 25,252,642 S2P unknown Het
Sfrp5 A G 19: 42,198,797 V278A probably benign Het
Taar1 T A 10: 23,920,624 C73* probably null Het
Tek T A 4: 94,827,685 L448Q probably benign Het
Tmem132a A C 19: 10,858,469 L899R probably damaging Het
Txndc5 T C 13: 38,527,869 probably benign Het
Uck1 C A 2: 32,260,141 probably benign Het
Uggt1 A G 1: 36,173,487 S925P probably damaging Het
Unc13d A T 11: 116,067,831 D786E probably damaging Het
Vmn1r26 T C 6: 58,008,743 T154A possibly damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R8559:Gucy2g UTSW 19 55210354 missense probably benign 0.10
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATAGGTTCCCACGAAAG -3'
(R):5'- GCATCGTCTCTAAATTCTGAGC -3'

Sequencing Primer
(F):5'- TCTGACCATTTAGCCCACAG -3'
(R):5'- GAGCCTGCTTCCTTCTGGG -3'
Posted On2020-10-20