Incidental Mutation 'R8443:Gucy1a1'
ID 654286
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Name guanylate cyclase 1, soluble, alpha 1
Synonyms sGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 82092427-82145789 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 82097693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 595 (C595Y)
Ref Sequence ENSEMBL: ENSMUSP00000048918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
AlphaFold Q9ERL9
Predicted Effect probably damaging
Transcript: ENSMUST00000048976
AA Change: C595Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: C595Y

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192289
Predicted Effect probably damaging
Transcript: ENSMUST00000193924
AA Change: C595Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: C595Y

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
2410089E03Rik A G 15: 8,201,151 I971V probably benign Het
Abcc6 C T 7: 45,980,025 V1293M probably damaging Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Cep290 A T 10: 100,495,844 I180F possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pde3b A G 7: 114,526,894 M788V probably damaging Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Tmprss3 T C 17: 31,195,002 D56G possibly damaging Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82111191 missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82108619 missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82109253 missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82097733 missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82118917 missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82109097 missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82113287 missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82097681 missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82119024 missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82106015 missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82108787 missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82094896 missense unknown
R0907:Gucy1a1 UTSW 3 82111191 missense probably benign 0.00
R1242:Gucy1a1 UTSW 3 82105953 splice site probably null
R1625:Gucy1a1 UTSW 3 82102055 missense probably benign 0.02
R1671:Gucy1a1 UTSW 3 82106222 missense probably damaging 1.00
R2056:Gucy1a1 UTSW 3 82109285 missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82113332 missense probably benign
R2140:Gucy1a1 UTSW 3 82118886 splice site probably null
R2154:Gucy1a1 UTSW 3 82111151 critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82108922 missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82097624 missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82094795 missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82119162 utr 5 prime probably benign
R5528:Gucy1a1 UTSW 3 82109073 missense probably damaging 1.00
R5933:Gucy1a1 UTSW 3 82094807 missense probably damaging 0.96
R6278:Gucy1a1 UTSW 3 82097634 missense probably damaging 1.00
R6385:Gucy1a1 UTSW 3 82109006 missense probably benign
R7011:Gucy1a1 UTSW 3 82109115 missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82097720 missense probably damaging 1.00
R7648:Gucy1a1 UTSW 3 82108707 missense possibly damaging 0.63
R7709:Gucy1a1 UTSW 3 82094789 missense unknown
R7770:Gucy1a1 UTSW 3 82108805 missense possibly damaging 0.95
R8531:Gucy1a1 UTSW 3 82111161 missense probably benign
R8872:Gucy1a1 UTSW 3 82108742 missense probably damaging 0.99
R9055:Gucy1a1 UTSW 3 82109126 missense possibly damaging 0.73
R9168:Gucy1a1 UTSW 3 82102046 missense probably damaging 0.97
R9231:Gucy1a1 UTSW 3 82106001 missense probably damaging 1.00
R9316:Gucy1a1 UTSW 3 82108943 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CATTCCATTCTCCCAGAAGATCG -3'
(R):5'- CTCACTGGGGCTTTCAAAGG -3'

Sequencing Primer
(F):5'- TTCTCCCAGAAGATCGCCAAGAG -3'
(R):5'- CAAAGGGTGTGGTGTTATTAGTTAC -3'
Posted On 2020-10-20