Incidental Mutation 'R8443:Abcc6'
ID 654298
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 45980025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1293 (V1293M)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: V1293M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: V1293M

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211220
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
2410089E03Rik A G 15: 8,201,151 I971V probably benign Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Cep290 A T 10: 100,495,844 I180F possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Gucy1a1 C T 3: 82,097,693 C595Y probably damaging Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pde3b A G 7: 114,526,894 M788V probably damaging Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Tmprss3 T C 17: 31,195,002 D56G possibly damaging Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCATACCATAGCTCCCTC -3'
(R):5'- CATGCTCAGTGGAGGGTGAG -3'

Sequencing Primer
(F):5'- CCCCCATCTCTCTCCAGGG -3'
(R):5'- ATGGAGGCACTTTCTCACCTGAAG -3'
Posted On 2020-10-20