Incidental Mutation 'R8443:Pde3b'
ID 654305
Institutional Source Beutler Lab
Gene Symbol Pde3b
Ensembl Gene ENSMUSG00000030671
Gene Name phosphodiesterase 3B, cGMP-inhibited
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 114415281-114539251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114526894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 788 (M788V)
Ref Sequence ENSEMBL: ENSMUSP00000032909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032909]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032909
AA Change: M788V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032909
Gene: ENSMUSG00000030671
AA Change: M788V

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
transmembrane domain 73 90 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
HDc 710 927 7.52e-4 SMART
low complexity region 991 1023 N/A INTRINSIC
low complexity region 1048 1067 N/A INTRINSIC
low complexity region 1081 1096 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutants show abnormalities in glycerol and fatty acid levels, along with changes in adipocyte morphology and decreased body fat percentage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
2410089E03Rik A G 15: 8,201,151 I971V probably benign Het
Abcc6 C T 7: 45,980,025 V1293M probably damaging Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Cep290 A T 10: 100,495,844 I180F possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Gucy1a1 C T 3: 82,097,693 C595Y probably damaging Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Tmprss3 T C 17: 31,195,002 D56G possibly damaging Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in Pde3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Pde3b APN 7 114518410 missense probably benign 0.00
IGL01637:Pde3b APN 7 114526901 nonsense probably null
IGL02004:Pde3b APN 7 114519617 missense possibly damaging 0.67
IGL02113:Pde3b APN 7 114526906 missense probably damaging 1.00
IGL02201:Pde3b APN 7 114534608 missense probably damaging 1.00
IGL02266:Pde3b APN 7 114526966 missense probably damaging 1.00
IGL02601:Pde3b APN 7 114523342 missense probably damaging 1.00
IGL02641:Pde3b APN 7 114530817 missense probably damaging 1.00
IGL02671:Pde3b APN 7 114523345 missense possibly damaging 0.77
IGL02691:Pde3b APN 7 114508085 splice site probably benign
IGL02719:Pde3b APN 7 114506248 missense probably damaging 1.00
IGL03092:Pde3b APN 7 114523348 missense probably damaging 1.00
FR4342:Pde3b UTSW 7 114534775 small insertion probably benign
R0208:Pde3b UTSW 7 114497981 missense probably benign 0.00
R1191:Pde3b UTSW 7 114519575 missense probably benign 0.01
R1514:Pde3b UTSW 7 114530766 missense probably damaging 0.98
R1612:Pde3b UTSW 7 114519556 nonsense probably null
R2081:Pde3b UTSW 7 114523422 missense probably benign
R2433:Pde3b UTSW 7 114526837 missense probably benign 0.30
R2508:Pde3b UTSW 7 114526857 nonsense probably null
R3842:Pde3b UTSW 7 114526867 missense probably damaging 1.00
R4082:Pde3b UTSW 7 114494588 missense probably benign 0.04
R4115:Pde3b UTSW 7 114521727 missense probably damaging 1.00
R4197:Pde3b UTSW 7 114530872 splice site probably benign
R4236:Pde3b UTSW 7 114521688 missense possibly damaging 0.62
R4355:Pde3b UTSW 7 114416287 missense probably benign
R4411:Pde3b UTSW 7 114534749 small deletion probably benign
R4430:Pde3b UTSW 7 114534670 missense probably damaging 1.00
R4901:Pde3b UTSW 7 114508190 missense probably damaging 0.99
R4969:Pde3b UTSW 7 114519612 missense possibly damaging 0.92
R5314:Pde3b UTSW 7 114494537 missense probably damaging 1.00
R5346:Pde3b UTSW 7 114506190 missense probably benign 0.00
R5706:Pde3b UTSW 7 114521692 missense probably damaging 1.00
R5844:Pde3b UTSW 7 114508871 missense probably benign 0.01
R6014:Pde3b UTSW 7 114416440 missense probably damaging 1.00
R6048:Pde3b UTSW 7 114508267 missense probably benign 0.00
R6190:Pde3b UTSW 7 114523032 splice site probably null
R7220:Pde3b UTSW 7 114536062 missense probably damaging 0.97
R7239:Pde3b UTSW 7 114416149 missense probably damaging 0.99
R7818:Pde3b UTSW 7 114491440 missense probably damaging 0.99
R7869:Pde3b UTSW 7 114494687 missense probably benign 0.03
R8483:Pde3b UTSW 7 114519568 missense probably benign 0.15
R8516:Pde3b UTSW 7 114526849 missense probably benign 0.01
R8754:Pde3b UTSW 7 114416043 missense possibly damaging 0.90
R9017:Pde3b UTSW 7 114416460 nonsense probably null
R9221:Pde3b UTSW 7 114415462 start gained probably benign
R9302:Pde3b UTSW 7 114523386 missense probably damaging 1.00
R9799:Pde3b UTSW 7 114523378 missense probably damaging 1.00
RF051:Pde3b UTSW 7 114534775 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AATGTCCTGCAAGATAAACAATGGG -3'
(R):5'- AGCATTCATCATCATGTGCTTTCAC -3'

Sequencing Primer
(F):5'- GGTAGACTTGGTTCTGGAC -3'
(R):5'- GTTTACTGAAAACATGACTCACAAG -3'
Posted On 2020-10-20