Incidental Mutation 'R8443:Cep290'
ID654319
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Namecentrosomal protein 290
Synonymsb2b1454Clo, Nphp6, b2b1752Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R8443 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location100487558-100574840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100495844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 180 (I180F)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164751
AA Change: I180F

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: I180F

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: I173F

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220346
AA Change: I180F

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
2410089E03Rik A G 15: 8,201,151 I971V probably benign Het
Abcc6 C T 7: 45,980,025 V1293M probably damaging Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Gucy1a1 C T 3: 82,097,693 C595Y probably damaging Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pde3b A G 7: 114,526,894 M788V probably damaging Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Tmprss3 T C 17: 31,195,002 D56G possibly damaging Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100508724 missense probably benign 0.00
IGL00499:Cep290 APN 10 100543327 missense probably damaging 1.00
IGL00547:Cep290 APN 10 100510708 missense probably damaging 0.99
IGL00573:Cep290 APN 10 100540361 missense probably damaging 1.00
IGL00646:Cep290 APN 10 100501154 missense probably benign 0.15
IGL00755:Cep290 APN 10 100531104 missense probably damaging 1.00
IGL00835:Cep290 APN 10 100563380 nonsense probably null
IGL00846:Cep290 APN 10 100540333 splice site probably benign
IGL00985:Cep290 APN 10 100567161 splice site probably benign
IGL01687:Cep290 APN 10 100500205 missense probably damaging 1.00
IGL01782:Cep290 APN 10 100545125 nonsense probably null
IGL02010:Cep290 APN 10 100508707 missense probably benign 0.39
IGL02010:Cep290 APN 10 100561345 missense probably benign 0.00
IGL02036:Cep290 APN 10 100558100 nonsense probably null
IGL02039:Cep290 APN 10 100514602 critical splice donor site probably null
IGL02532:Cep290 APN 10 100545065 missense probably benign 0.04
IGL02950:Cep290 APN 10 100540329 splice site probably benign
IGL03105:Cep290 APN 10 100551824 missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100568088 missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100537801 missense probably benign 0.09
IGL03401:Cep290 APN 10 100500265 missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100537591 missense probably benign 0.28
R0025:Cep290 UTSW 10 100537831 missense probably damaging 1.00
R0127:Cep290 UTSW 10 100536925 splice site probably benign
R0254:Cep290 UTSW 10 100514574 missense probably benign 0.31
R0295:Cep290 UTSW 10 100537821 missense probably damaging 0.99
R0371:Cep290 UTSW 10 100518564 splice site probably benign
R0390:Cep290 UTSW 10 100508758 missense probably benign 0.09
R0399:Cep290 UTSW 10 100554400 splice site probably benign
R0413:Cep290 UTSW 10 100523314 nonsense probably null
R0427:Cep290 UTSW 10 100516179 missense probably benign 0.01
R0472:Cep290 UTSW 10 100551455 missense probably benign 0.19
R0485:Cep290 UTSW 10 100549344 missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100492676 missense probably damaging 1.00
R0675:Cep290 UTSW 10 100568813 critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100518762 missense probably benign 0.08
R1238:Cep290 UTSW 10 100517863 missense probably damaging 1.00
R1297:Cep290 UTSW 10 100539100 splice site probably benign
R1368:Cep290 UTSW 10 100494966 splice site probably benign
R1394:Cep290 UTSW 10 100537529 missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100572101 missense probably benign 0.00
R1493:Cep290 UTSW 10 100562181 missense probably benign 0.21
R1496:Cep290 UTSW 10 100538966 missense probably damaging 1.00
R1539:Cep290 UTSW 10 100496828 missense probably benign 0.06
R1598:Cep290 UTSW 10 100549329 missense probably damaging 1.00
R1616:Cep290 UTSW 10 100568836 missense probably benign
R1712:Cep290 UTSW 10 100554499 missense probably benign 0.02
R1753:Cep290 UTSW 10 100513981 missense probably benign
R1773:Cep290 UTSW 10 100510573 missense probably benign
R1775:Cep290 UTSW 10 100496810 missense probably damaging 0.98
R1799:Cep290 UTSW 10 100516196 missense probably benign 0.00
R1937:Cep290 UTSW 10 100497953 missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100531184 missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100512400 critical splice donor site probably null
R2164:Cep290 UTSW 10 100518795 missense probably damaging 0.96
R2393:Cep290 UTSW 10 100561238 critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100537437 missense probably benign 0.19
R3612:Cep290 UTSW 10 100541581 nonsense probably null
R3800:Cep290 UTSW 10 100572941 missense probably damaging 0.97
R4005:Cep290 UTSW 10 100539008 missense probably damaging 1.00
R4039:Cep290 UTSW 10 100512401 critical splice donor site probably null
R4259:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4260:Cep290 UTSW 10 100514492 missense probably damaging 1.00
R4319:Cep290 UTSW 10 100539047 missense probably benign 0.09
R4329:Cep290 UTSW 10 100537668 missense probably damaging 0.98
R4573:Cep290 UTSW 10 100518850 missense probably benign
R4614:Cep290 UTSW 10 100508740 missense probably benign
R4614:Cep290 UTSW 10 100559687 missense possibly damaging 0.93
R4708:Cep290 UTSW 10 100523264 missense probably benign 0.02
R4727:Cep290 UTSW 10 100563270 missense probably benign 0.05
R4825:Cep290 UTSW 10 100488348 missense probably damaging 0.96
R4839:Cep290 UTSW 10 100508786 missense probably damaging 0.99
R4858:Cep290 UTSW 10 100494911 missense probably benign 0.31
R4871:Cep290 UTSW 10 100548914 missense probably benign 0.22
R5094:Cep290 UTSW 10 100567030 missense probably damaging 0.97
R5103:Cep290 UTSW 10 100539020 missense probably damaging 1.00
R5499:Cep290 UTSW 10 100537653 missense probably damaging 0.99
R5505:Cep290 UTSW 10 100499186 critical splice donor site probably null
R5615:Cep290 UTSW 10 100531150 missense probably damaging 1.00
R5815:Cep290 UTSW 10 100558108 missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100523399 missense probably benign 0.44
R5889:Cep290 UTSW 10 100499074 missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100551830 missense probably damaging 0.99
R5992:Cep290 UTSW 10 100543321 missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100541787 missense probably damaging 1.00
R6213:Cep290 UTSW 10 100523360 missense probably benign 0.06
R6274:Cep290 UTSW 10 100530207 missense probably damaging 1.00
R6285:Cep290 UTSW 10 100523329 missense probably benign 0.17
R6306:Cep290 UTSW 10 100531166 missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100508776 missense probably benign 0.01
R6649:Cep290 UTSW 10 100518531 missense probably benign 0.28
R6692:Cep290 UTSW 10 100569144 splice site probably null
R6788:Cep290 UTSW 10 100488628 missense probably damaging 1.00
R6847:Cep290 UTSW 10 100563419 missense probably damaging 1.00
R6947:Cep290 UTSW 10 100530056 missense probably damaging 1.00
R7035:Cep290 UTSW 10 100499071 missense probably benign 0.07
R7073:Cep290 UTSW 10 100539003 missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100543358 missense probably damaging 0.98
R7256:Cep290 UTSW 10 100546498 missense probably damaging 1.00
R7258:Cep290 UTSW 10 100499108 missense probably benign 0.01
R7311:Cep290 UTSW 10 100537718 missense probably damaging 0.98
R7505:Cep290 UTSW 10 100516265 missense probably benign 0.01
R7615:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7643:Cep290 UTSW 10 100537553 missense probably benign
R7662:Cep290 UTSW 10 100537803 missense probably benign 0.21
R7663:Cep290 UTSW 10 100554536 critical splice donor site probably null
R7685:Cep290 UTSW 10 100540057 missense probably benign 0.19
R7699:Cep290 UTSW 10 100540369 missense probably benign 0.33
R7717:Cep290 UTSW 10 100492681 missense probably benign 0.03
R7747:Cep290 UTSW 10 100558176 nonsense probably null
R7757:Cep290 UTSW 10 100563434 missense probably benign
R7843:Cep290 UTSW 10 100516188 missense possibly damaging 0.49
R7905:Cep290 UTSW 10 100554490 missense probably benign
R8078:Cep290 UTSW 10 100572887 missense probably benign 0.04
R8081:Cep290 UTSW 10 100558176 nonsense probably null
R8094:Cep290 UTSW 10 100544931 missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100559671 missense probably benign 0.08
R8305:Cep290 UTSW 10 100544934 missense probably benign 0.09
R8325:Cep290 UTSW 10 100517808 missense probably benign 0.03
R8372:Cep290 UTSW 10 100549341 missense probably benign 0.00
Z1176:Cep290 UTSW 10 100549374 critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100497944 missense probably benign
Z1177:Cep290 UTSW 10 100538997 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTGTCCTTTTGAAGAACAAACGTC -3'
(R):5'- ACCCCAGCCTGGTAATACATTTG -3'

Sequencing Primer
(F):5'- TGAGGCCCTAAGGGTAGTTAAAGC -3'
(R):5'- TTGTAAAACCAAGCCTCTGAACTG -3'
Posted On2020-10-20