Incidental Mutation 'R8443:Casc3'
ID 654325
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name exon junction complex subunit
Synonyms Mln51, Btz
MMRRC Submission 067825-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 98700634-98724633 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98713607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect probably damaging
Transcript: ENSMUST00000017384
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169695
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 C T 7: 45,629,449 (GRCm39) V1293M probably damaging Het
Agt A G 8: 125,290,537 (GRCm39) W257R possibly damaging Het
Arhgef11 T A 3: 87,620,406 (GRCm39) N457K probably benign Het
Bcl3 G T 7: 19,554,082 (GRCm39) H95Q probably benign Het
C1d T A 11: 17,213,662 (GRCm39) N64K probably damaging Het
Cd300c2 C T 11: 114,891,466 (GRCm39) S136N probably benign Het
Cdh8 A G 8: 99,757,672 (GRCm39) V642A possibly damaging Het
Cep290 A T 10: 100,331,706 (GRCm39) I180F possibly damaging Het
Copz2 A G 11: 96,744,887 (GRCm39) E86G probably damaging Het
Cplane1 A G 15: 8,230,635 (GRCm39) I971V probably benign Het
Cracdl A G 1: 37,652,537 (GRCm39) V1090A probably benign Het
Csf3r A T 4: 125,923,712 (GRCm39) D74V possibly damaging Het
Cyp11b1 T G 15: 74,710,789 (GRCm39) E257A possibly damaging Het
Dlg2 A G 7: 92,024,875 (GRCm39) Q580R probably damaging Het
Dnai2 A T 11: 114,645,275 (GRCm39) K570M unknown Het
Dock8 A G 19: 25,133,281 (GRCm39) K1143E probably benign Het
Dxo T C 17: 35,058,099 (GRCm39) S394P probably benign Het
Etl4 A G 2: 20,810,977 (GRCm39) D1388G probably benign Het
F13a1 C A 13: 37,209,692 (GRCm39) R91L probably damaging Het
Fam50b C T 13: 34,930,856 (GRCm39) R111* probably null Het
Fat2 T G 11: 55,202,535 (GRCm39) N180H probably damaging Het
Fitm2 A T 2: 163,311,768 (GRCm39) H148Q probably benign Het
Fjx1 A T 2: 102,281,156 (GRCm39) S260T possibly damaging Het
Fos T C 12: 85,522,466 (GRCm39) L165P probably damaging Het
Gm39115 C A 7: 141,689,710 (GRCm39) C21F unknown Het
Gucy1a1 C T 3: 82,005,000 (GRCm39) C595Y probably damaging Het
Hectd4 G T 5: 121,467,172 (GRCm39) W2478L possibly damaging Het
I830077J02Rik T A 3: 105,836,060 (GRCm39) K9N probably damaging Het
Ift70a1 T C 2: 75,811,519 (GRCm39) D188G probably benign Het
Ireb2 T C 9: 54,811,265 (GRCm39) F723L possibly damaging Het
Itpr1 G A 6: 108,496,309 (GRCm39) V2580I probably damaging Het
Kcnu1 G A 8: 26,382,092 (GRCm39) G481R probably damaging Het
Kdm3b G T 18: 34,926,129 (GRCm39) A90S probably benign Het
Klra8 A G 6: 130,105,056 (GRCm39) V23A probably damaging Het
Lig4 A G 8: 10,023,777 (GRCm39) M1T probably null Het
Lpin3 C T 2: 160,737,273 (GRCm39) P107S probably damaging Het
Lrp1b T A 2: 41,265,867 (GRCm39) K1100* probably null Het
Obscn G A 11: 58,929,700 (GRCm39) H5172Y probably damaging Het
Or10a3m T A 7: 108,313,418 (GRCm39) M286K possibly damaging Het
Or4p20 A G 2: 88,253,745 (GRCm39) I208T probably benign Het
Or5ae1 C T 7: 84,565,787 (GRCm39) H267Y probably benign Het
Or6z1 T A 7: 6,504,734 (GRCm39) T170S probably damaging Het
Or8c14-ps1 A T 9: 38,101,498 (GRCm39) H159L possibly damaging Het
Orc3 A G 4: 34,593,173 (GRCm39) L298P probably damaging Het
Otub1 A G 19: 7,177,360 (GRCm39) F96L probably damaging Het
Pcnx3 A G 19: 5,736,670 (GRCm39) S156P probably benign Het
Pde3b A G 7: 114,126,129 (GRCm39) M788V probably damaging Het
Pias4 A G 10: 80,992,844 (GRCm39) probably null Het
Polg A G 7: 79,114,743 (GRCm39) C73R probably benign Het
Ptbp2 T C 3: 119,541,467 (GRCm39) Y190C probably damaging Het
Rab33b T A 3: 51,401,050 (GRCm39) F175I probably damaging Het
Rfx1 A G 8: 84,806,515 (GRCm39) T108A probably benign Het
Ribc2 A G 15: 85,019,461 (GRCm39) D81G probably benign Het
Rnf213 T G 11: 119,340,149 (GRCm39) M3460R Het
Rsf1 T A 7: 97,266,103 (GRCm39) S86T Het
Rxfp2 C A 5: 149,973,068 (GRCm39) T181N possibly damaging Het
Samm50 G A 15: 84,094,702 (GRCm39) E365K possibly damaging Het
Shld2 A C 14: 33,989,942 (GRCm39) N321K probably benign Het
Slc22a18 T C 7: 143,051,123 (GRCm39) V334A probably damaging Het
Slc23a3 A T 1: 75,110,085 (GRCm39) C97S probably benign Het
Smchd1 T A 17: 71,714,244 (GRCm39) H873L probably benign Het
Snrpa1 G A 7: 65,720,381 (GRCm39) G195R probably benign Het
Sphkap T A 1: 83,255,953 (GRCm39) I599F probably benign Het
Stox1 A G 10: 62,501,543 (GRCm39) V339A probably damaging Het
Tlx1 A G 19: 45,142,036 (GRCm39) E220G probably damaging Het
Tmem71 C A 15: 66,413,421 (GRCm39) probably null Het
Tmprss3 T C 17: 31,413,976 (GRCm39) D56G possibly damaging Het
Trabd A G 15: 88,970,107 (GRCm39) R368G probably benign Het
Trf A G 9: 103,094,675 (GRCm39) I461T probably damaging Het
Trpm3 A G 19: 22,676,226 (GRCm39) T133A possibly damaging Het
Trpv3 G A 11: 73,186,209 (GRCm39) V667I possibly damaging Het
Vps13b T A 15: 35,455,246 (GRCm39) N718K probably benign Het
Zdbf2 T C 1: 63,345,166 (GRCm39) S1182P possibly damaging Het
Zfp13 T C 17: 23,795,866 (GRCm39) D235G probably benign Het
Zfp407 T C 18: 84,227,987 (GRCm39) E1874G probably damaging Het
Zfp503 T C 14: 22,036,277 (GRCm39) K213R probably benign Het
Zkscan2 A G 7: 123,084,651 (GRCm39) V491A probably damaging Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98,714,028 (GRCm39) missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98,714,227 (GRCm39) critical splice donor site probably null
IGL01901:Casc3 APN 11 98,713,947 (GRCm39) missense probably damaging 1.00
IGL02345:Casc3 APN 11 98,718,390 (GRCm39) splice site probably benign
IGL02875:Casc3 APN 11 98,712,378 (GRCm39) missense probably damaging 1.00
IGL02964:Casc3 APN 11 98,719,749 (GRCm39) missense probably damaging 0.96
R0147:Casc3 UTSW 11 98,713,325 (GRCm39) missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98,712,319 (GRCm39) missense probably damaging 0.99
R0763:Casc3 UTSW 11 98,722,144 (GRCm39) missense probably damaging 1.00
R1581:Casc3 UTSW 11 98,713,644 (GRCm39) missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98,712,332 (GRCm39) missense probably benign 0.01
R4380:Casc3 UTSW 11 98,713,857 (GRCm39) missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98,713,784 (GRCm39) missense probably benign 0.13
R4988:Casc3 UTSW 11 98,712,700 (GRCm39) splice site probably null
R5079:Casc3 UTSW 11 98,701,252 (GRCm39) intron probably benign
R5442:Casc3 UTSW 11 98,712,297 (GRCm39) missense probably damaging 0.99
R5511:Casc3 UTSW 11 98,701,740 (GRCm39) nonsense probably null
R5873:Casc3 UTSW 11 98,712,270 (GRCm39) missense unknown
R6041:Casc3 UTSW 11 98,719,385 (GRCm39) missense probably damaging 1.00
R6685:Casc3 UTSW 11 98,713,356 (GRCm39) missense probably damaging 0.99
R7030:Casc3 UTSW 11 98,713,359 (GRCm39) missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98,718,413 (GRCm39) missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98,712,311 (GRCm39) missense probably benign 0.04
R7659:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R7660:Casc3 UTSW 11 98,700,699 (GRCm39) missense unknown
R8444:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
R8491:Casc3 UTSW 11 98,713,977 (GRCm39) missense probably benign 0.27
R8516:Casc3 UTSW 11 98,713,607 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTTGGAACATCTCCCTGAC -3'
(R):5'- TGACCGGTAACTAGCTTCATG -3'

Sequencing Primer
(F):5'- GGAACATCTCCCTGACTCCTTTGG -3'
(R):5'- GCTTCATGCTTAAGAGTCTCAGCAG -3'
Posted On 2020-10-20