Incidental Mutation 'R8443:2410089E03Rik'
ID 654334
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene Name RIKEN cDNA 2410089E03 gene
Synonyms b2b012Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8169106-8271158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8201151 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 971 (I971V)
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110617
AA Change: I971V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801
AA Change: I971V

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
Abcc6 C T 7: 45,980,025 V1293M probably damaging Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Cep290 A T 10: 100,495,844 I180F possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Gucy1a1 C T 3: 82,097,693 C595Y probably damaging Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pde3b A G 7: 114,526,894 M788V probably damaging Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Tmprss3 T C 17: 31,195,002 D56G possibly damaging Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7983:2410089E03Rik UTSW 15 8221815 missense probably benign 0.01
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
R8088:2410089E03Rik UTSW 15 8186318 missense probably benign 0.00
R8231:2410089E03Rik UTSW 15 8219027 missense probably benign 0.16
R8480:2410089E03Rik UTSW 15 8187458 missense possibly damaging 0.63
R8693:2410089E03Rik UTSW 15 8229008 missense probably benign 0.15
R8785:2410089E03Rik UTSW 15 8174760 missense probably benign 0.39
R8791:2410089E03Rik UTSW 15 8187260 missense probably damaging 1.00
R8822:2410089E03Rik UTSW 15 8171778 missense probably damaging 1.00
R8831:2410089E03Rik UTSW 15 8182136 missense probably benign 0.09
R8932:2410089E03Rik UTSW 15 8194375 missense probably damaging 1.00
R8968:2410089E03Rik UTSW 15 8201281 missense possibly damaging 0.84
R8973:2410089E03Rik UTSW 15 8203793 missense probably damaging 1.00
R9036:2410089E03Rik UTSW 15 8223138 missense possibly damaging 0.63
R9134:2410089E03Rik UTSW 15 8199232 missense probably damaging 0.99
R9197:2410089E03Rik UTSW 15 8251052 missense unknown
R9259:2410089E03Rik UTSW 15 8203303 missense possibly damaging 0.82
R9269:2410089E03Rik UTSW 15 8219016 missense probably damaging 0.97
R9294:2410089E03Rik UTSW 15 8203327 missense probably benign 0.00
R9328:2410089E03Rik UTSW 15 8186208 missense probably damaging 1.00
R9563:2410089E03Rik UTSW 15 8187079 missense probably benign 0.20
R9680:2410089E03Rik UTSW 15 8202301 missense possibly damaging 0.68
R9721:2410089E03Rik UTSW 15 8225409 missense unknown
R9779:2410089E03Rik UTSW 15 8201302 missense possibly damaging 0.93
R9780:2410089E03Rik UTSW 15 8228639 missense probably benign 0.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCACAGCCCATTTAAGGAAGC -3'
(R):5'- ATCCATACCGCGCAAAATTG -3'

Sequencing Primer
(F):5'- CAGCCCATTTAAGGAAGCATATATC -3'
(R):5'- GTTTACAGAACACTTGGTAGGCCAC -3'
Posted On 2020-10-20