Incidental Mutation 'R8443:Tmprss3'
ID 654342
Institutional Source Beutler Lab
Gene Symbol Tmprss3
Ensembl Gene ENSMUSG00000024034
Gene Name transmembrane protease, serine 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8443 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 31179272-31198975 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 31195002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000110196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024833] [ENSMUST00000114549]
AlphaFold Q8K1T0
Predicted Effect probably benign
Transcript: ENSMUST00000024833
AA Change: D34G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000024833
Gene: ENSMUSG00000024034
AA Change: D34G

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
LDLa 72 109 1.76e-5 SMART
SR 108 205 3.99e-4 SMART
Tryp_SPc 216 443 5.22e-96 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114549
AA Change: D56G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110196
Gene: ENSMUSG00000024034
AA Change: D56G

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
LDLa 94 131 1.76e-5 SMART
SR 130 227 3.99e-4 SMART
Tryp_SPc 238 465 5.22e-96 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit early onset deafness and disrupted vestibular function associated with hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A G 1: 37,613,456 V1090A probably benign Het
2410089E03Rik A G 15: 8,201,151 I971V probably benign Het
Abcc6 C T 7: 45,980,025 V1293M probably damaging Het
Agt A G 8: 124,563,798 W257R possibly damaging Het
Arhgef11 T A 3: 87,713,099 N457K probably benign Het
Bcl3 G T 7: 19,820,157 H95Q probably benign Het
C1d T A 11: 17,263,662 N64K probably damaging Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd300c2 C T 11: 115,000,640 S136N probably benign Het
Cdh8 A G 8: 99,031,040 V642A possibly damaging Het
Cep290 A T 10: 100,495,844 I180F possibly damaging Het
Copz2 A G 11: 96,854,061 E86G probably damaging Het
Csf3r A T 4: 126,029,919 D74V possibly damaging Het
Cyp11b1 T G 15: 74,838,940 E257A possibly damaging Het
Dlg2 A G 7: 92,375,667 Q580R probably damaging Het
Dnaic2 A T 11: 114,754,449 K570M unknown Het
Dock8 A G 19: 25,155,917 K1143E probably benign Het
Dxo T C 17: 34,839,123 S394P probably benign Het
Etl4 A G 2: 20,806,166 D1388G probably benign Het
F13a1 C A 13: 37,025,718 R91L probably damaging Het
Fam35a A C 14: 34,267,985 N321K probably benign Het
Fam50b C T 13: 34,746,873 R111* probably null Het
Fat2 T G 11: 55,311,709 N180H probably damaging Het
Fitm2 A T 2: 163,469,848 H148Q probably benign Het
Fjx1 A T 2: 102,450,811 S260T possibly damaging Het
Fos T C 12: 85,475,692 L165P probably damaging Het
Gm39115 C A 7: 142,135,973 C21F unknown Het
Gucy1a1 C T 3: 82,097,693 C595Y probably damaging Het
Hectd4 G T 5: 121,329,109 W2478L possibly damaging Het
I830077J02Rik T A 3: 105,928,744 K9N probably damaging Het
Ireb2 T C 9: 54,903,981 F723L possibly damaging Het
Itpr1 G A 6: 108,519,348 V2580I probably damaging Het
Kcnu1 G A 8: 25,892,064 G481R probably damaging Het
Kdm3b G T 18: 34,793,076 A90S probably benign Het
Klra8 A G 6: 130,128,093 V23A probably damaging Het
Lig4 A G 8: 9,973,777 M1T probably null Het
Lpin3 C T 2: 160,895,353 P107S probably damaging Het
Lrp1b T A 2: 41,375,855 K1100* probably null Het
Obscn G A 11: 59,038,874 H5172Y probably damaging Het
Olfr1181 A G 2: 88,423,401 I208T probably benign Het
Olfr1348 T A 7: 6,501,735 T170S probably damaging Het
Olfr290 C T 7: 84,916,579 H267Y probably benign Het
Olfr512 T A 7: 108,714,211 M286K possibly damaging Het
Olfr892-ps1 A T 9: 38,190,202 H159L possibly damaging Het
Orc3 A G 4: 34,593,173 L298P probably damaging Het
Otub1 A G 19: 7,199,995 F96L probably damaging Het
Pcnx3 A G 19: 5,686,642 S156P probably benign Het
Pde3b A G 7: 114,526,894 M788V probably damaging Het
Pias4 A G 10: 81,157,010 probably null Het
Polg A G 7: 79,464,995 C73R probably benign Het
Ptbp2 T C 3: 119,747,818 Y190C probably damaging Het
Rab33b T A 3: 51,493,629 F175I probably damaging Het
Rfx1 A G 8: 84,079,886 T108A probably benign Het
Ribc2 A G 15: 85,135,260 D81G probably benign Het
Rnf213 T G 11: 119,449,323 M3460R Het
Rsf1 T A 7: 97,616,896 S86T Het
Rxfp2 C A 5: 150,049,603 T181N possibly damaging Het
Samm50 G A 15: 84,210,501 E365K possibly damaging Het
Slc22a18 T C 7: 143,497,386 V334A probably damaging Het
Slc23a3 A T 1: 75,133,441 C97S probably benign Het
Smchd1 T A 17: 71,407,249 H873L probably benign Het
Snrpa1 G A 7: 66,070,633 G195R probably benign Het
Sphkap T A 1: 83,278,232 I599F probably benign Het
Stox1 A G 10: 62,665,764 V339A probably damaging Het
Tlx1 A G 19: 45,153,597 E220G probably damaging Het
Tmem71 C A 15: 66,541,572 probably null Het
Trabd A G 15: 89,085,904 R368G probably benign Het
Trf A G 9: 103,217,476 I461T probably damaging Het
Trpm3 A G 19: 22,698,862 T133A possibly damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ttc30a1 T C 2: 75,981,175 D188G probably benign Het
Vps13b T A 15: 35,455,100 N718K probably benign Het
Zdbf2 T C 1: 63,306,007 S1182P possibly damaging Het
Zfp13 T C 17: 23,576,892 D235G probably benign Het
Zfp407 T C 18: 84,209,862 E1874G probably damaging Het
Zfp503 T C 14: 21,986,209 K213R probably benign Het
Zkscan2 A G 7: 123,485,428 V491A probably damaging Het
Other mutations in Tmprss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tmprss3 APN 17 31195008 missense probably damaging 0.97
IGL01836:Tmprss3 APN 17 31191044 missense probably benign
IGL02525:Tmprss3 APN 17 31194891 splice site probably benign
IGL02672:Tmprss3 APN 17 31191007 missense probably damaging 1.00
IGL02900:Tmprss3 APN 17 31184579 missense probably damaging 1.00
R0122:Tmprss3 UTSW 17 31193902 splice site probably benign
R0617:Tmprss3 UTSW 17 31193912 missense probably damaging 1.00
R4001:Tmprss3 UTSW 17 31186559 missense probably damaging 1.00
R5587:Tmprss3 UTSW 17 31193992 missense probably benign 0.00
R6077:Tmprss3 UTSW 17 31189167 missense possibly damaging 0.94
R6271:Tmprss3 UTSW 17 31186562 missense probably damaging 1.00
R6329:Tmprss3 UTSW 17 31183859 nonsense probably null
R6918:Tmprss3 UTSW 17 31188357 missense probably benign 0.19
R8279:Tmprss3 UTSW 17 31197735 missense probably benign 0.20
R8372:Tmprss3 UTSW 17 31184697 missense probably benign 0.00
R8427:Tmprss3 UTSW 17 31188384 missense probably damaging 0.99
R9041:Tmprss3 UTSW 17 31191040 missense probably benign 0.02
R9315:Tmprss3 UTSW 17 31184670 missense probably null 0.46
R9388:Tmprss3 UTSW 17 31191067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGCCACCAGTAATTAAG -3'
(R):5'- ACCCAGACAACGTGGTCATTC -3'

Sequencing Primer
(F):5'- GCCACCAGTAATTAAGGCCAGG -3'
(R):5'- CGTGGTCATTCATCTAACCAAGTCAG -3'
Posted On 2020-10-20