Mutagenetix > Incidental Mutation

Incidental Mutation 'R8444:Cdh20'

654354

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

067826-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R8444 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104898583 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 437 (F437I)

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

AlphaFold

Q9Z0M3

Predicted Effect

probably benign
Transcript: ENSMUST00000062528
AA Change: F437I

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: F437I

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010K14Rik	G	T	11: 70,127,755 (GRCm39)	R56S	possibly damaging	Het
Abca14	T	A	7: 119,918,133 (GRCm39)	I1545K	probably damaging	Het
Abca3	A	G	17: 24,602,959 (GRCm39)	Y518C	probably damaging	Het
Abcd2	A	G	15: 91,058,839 (GRCm39)	V535A	probably benign	Het
Adcy9	T	C	16: 4,106,487 (GRCm39)	T1113A	probably damaging	Het
Afdn	A	T	17: 14,104,062 (GRCm39)	N1133Y	probably benign	Het
Aip	T	A	19: 4,166,034 (GRCm39)	D139V	probably damaging	Het
Akap13	G	A	7: 75,380,213 (GRCm39)	R462H	probably damaging	Het
Aldh16a1	G	A	7: 44,799,115 (GRCm39)	P56S	probably benign	Het
Alpk3	A	C	7: 80,707,468 (GRCm39)	T31P	probably benign	Het
Aoc3	G	T	11: 101,232,573 (GRCm39)	R466S	unknown	Het
Atoh1	T	C	6: 64,706,641 (GRCm39)	L112P	probably benign	Het
Atp2b2	T	A	6: 113,770,772 (GRCm39)	N424I	probably benign	Het
Brms1	T	C	19: 5,091,520 (GRCm39)		probably null	Het
Casc3	C	T	11: 98,713,607 (GRCm39)	R280C	probably damaging	Het
Cd34	T	A	1: 194,640,808 (GRCm39)	S224R	probably benign	Het
Cdkal1	A	T	13: 29,510,087 (GRCm39)	V557E	probably benign	Het
Cfap276	A	G	3: 108,451,384 (GRCm39)	H115R	probably benign	Het
Chst5	T	C	8: 112,617,395 (GRCm39)	H75R	probably damaging	Het
Col5a2	A	T	1: 45,435,305 (GRCm39)	N713K	probably benign	Het
Cpne5	A	T	17: 29,407,357 (GRCm39)	M181K	probably benign	Het
Cpt1a	T	C	19: 3,431,981 (GRCm39)	F731S	probably benign	Het
Cyfip1	A	G	7: 55,521,902 (GRCm39)	M69V	possibly damaging	Het
Dennd3	A	G	15: 73,442,672 (GRCm39)	K1232E	probably benign	Het
Dennd4b	A	T	3: 90,181,259 (GRCm39)	H805L	probably benign	Het
Dnm1l	C	T	16: 16,158,906 (GRCm39)	R108Q	probably damaging	Het
Dsc1	T	A	18: 20,222,636 (GRCm39)	D612V	probably benign	Het
Ephb2	C	T	4: 136,388,711 (GRCm39)	G628R	probably damaging	Het
Esrrb	G	A	12: 86,552,595 (GRCm39)	R195H	probably benign	Het
Flg2	A	T	3: 93,107,585 (GRCm39)	E23D	probably damaging	Het
Gja8	A	G	3: 96,826,990 (GRCm39)	L224P	probably damaging	Het
Hps6	T	G	19: 45,993,867 (GRCm39)	S601R	possibly damaging	Het
Ice1	T	C	13: 70,752,495 (GRCm39)	E1197G	probably damaging	Het
Ifnar2	C	A	16: 91,200,857 (GRCm39)	A366D	possibly damaging	Het
Ighm	A	C	12: 113,384,813 (GRCm39)	S347A		Het
Immt	C	T	6: 71,848,492 (GRCm39)	R494*	probably null	Het
Irs2	A	G	8: 11,056,683 (GRCm39)	V583A	probably damaging	Het
Kcnk4	T	C	19: 6,903,508 (GRCm39)	E347G	probably damaging	Het
Kif5b	T	A	18: 6,213,245 (GRCm39)	I716F	probably benign	Het
Klhl1	T	A	14: 96,755,326 (GRCm39)	D143V	probably benign	Het
Lrp1b	T	C	2: 40,760,272 (GRCm39)	T2999A		Het
Map3k9	A	G	12: 81,768,970 (GRCm39)	L1026P	probably damaging	Het
Mtg1	T	C	7: 139,718,283 (GRCm39)	V54A	probably damaging	Het
Mx1	G	T	16: 97,252,687 (GRCm39)	C231*	probably null	Het
Odad4	G	T	11: 100,452,731 (GRCm39)		probably null	Het
Or10ag59	G	A	2: 87,406,083 (GRCm39)	M218I	probably benign	Het
Or56a41	A	G	7: 104,740,165 (GRCm39)	V227A	probably damaging	Het
Or5p6	C	A	7: 107,631,070 (GRCm39)	W160L	probably benign	Het
Or5p79	A	G	7: 108,221,027 (GRCm39)	I3V	probably benign	Het
Or6c65	T	A	10: 129,603,794 (GRCm39)	V143E	probably damaging	Het
Otogl	T	A	10: 107,692,975 (GRCm39)	E836D	probably benign	Het
Pde6d	A	G	1: 86,471,250 (GRCm39)	S143P	probably damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398 (GRCm39)		probably benign	Het
Pon1	C	T	6: 5,177,327 (GRCm39)	W194*	probably null	Het
Rbm25	T	A	12: 83,711,025 (GRCm39)	S379R	unknown	Het
Rnf111	A	T	9: 70,365,223 (GRCm39)	S415T	probably benign	Het
Shoc2	A	G	19: 53,976,503 (GRCm39)	Y131C	probably damaging	Het
Slc23a1	T	A	18: 35,757,489 (GRCm39)	M261L	possibly damaging	Het
Slc34a1	A	T	13: 24,003,061 (GRCm39)	H237L	probably benign	Het
Slc35d1	G	C	4: 103,071,896 (GRCm39)	I35M		Het
Slc8b1	C	T	5: 120,651,203 (GRCm39)		probably benign	Het
Smr3a	A	C	5: 88,152,611 (GRCm39)	L8F	unknown	Het
Snx8	G	A	5: 140,343,929 (GRCm39)	R96C	possibly damaging	Het
Srgap3	A	G	6: 112,752,509 (GRCm39)	V325A	possibly damaging	Het
Stk40	A	G	4: 126,012,127 (GRCm39)	T10A	probably benign	Het
Tmem177	A	T	1: 119,837,950 (GRCm39)	V243D	probably benign	Het
Trim6	G	A	7: 103,881,879 (GRCm39)	V403M	probably damaging	Het
Tysnd1	A	G	10: 61,531,950 (GRCm39)	R201G	probably benign	Het
Vmn2r67	A	T	7: 84,785,854 (GRCm39)	F717Y	probably benign	Het
Vmn2r72	A	G	7: 85,387,383 (GRCm39)	V727A	probably benign	Het
Wdr49	A	C	3: 75,358,997 (GRCm39)	D43E	probably benign	Het
Zbtb8b	A	G	4: 129,326,424 (GRCm39)	V247A	probably benign	Het
Zfp532	C	A	18: 65,757,330 (GRCm39)	A421E	possibly damaging	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2068:Cdh20	UTSW	1	110,065,666 (GRCm39)	nonsense	probably null
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCGCCATAAGGGTCTCAG -3'
(R):5'- TCTGAACCCAATGATGTACCTC -3'

Sequencing Primer
(F):5'- ATAAGGGTCTCAGCGCTCTG -3'
(R):5'- TGATGTACCTCAACCATAAAATGAAC -3'

Posted On

2020-10-20