Incidental Mutation 'R8444:Cyfip1'
ID654378
Institutional Source Beutler Lab
Gene Symbol Cyfip1
Ensembl Gene ENSMUSG00000030447
Gene Namecytoplasmic FMR1 interacting protein 1
Synonymsl(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8444 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location55841745-55932602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55872154 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 69 (M69V)
Ref Sequence ENSEMBL: ENSMUSP00000032629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000173783] [ENSMUST00000206862]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032629
AA Change: M69V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: M69V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085255
AA Change: M69V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: M69V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163845
AA Change: M69V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: M69V

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173783
AA Change: M69V

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134509
Gene: ENSMUSG00000030447
AA Change: M69V

DomainStartEndE-ValueType
PDB:4N78|A 1 230 1e-142 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000206862
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Aoc3 G T 11: 101,341,747 R466S unknown Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Hps6 T G 19: 46,005,428 S601R possibly damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Ighm A C 12: 113,421,193 S347A Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Cyfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cyfip1 APN 7 55904210 missense probably damaging 1.00
IGL01351:Cyfip1 APN 7 55898243 nonsense probably null
IGL01662:Cyfip1 APN 7 55896739 missense probably damaging 1.00
IGL02034:Cyfip1 APN 7 55898353 missense probably damaging 0.99
IGL02039:Cyfip1 APN 7 55875021 missense possibly damaging 0.90
IGL02063:Cyfip1 APN 7 55926348 missense probably damaging 1.00
IGL02429:Cyfip1 APN 7 55871982 splice site probably benign
IGL03256:Cyfip1 APN 7 55907434 missense possibly damaging 0.67
R0455:Cyfip1 UTSW 7 55892054 missense probably benign 0.18
R0546:Cyfip1 UTSW 7 55922816 nonsense probably null
R0671:Cyfip1 UTSW 7 55923962 splice site probably null
R0732:Cyfip1 UTSW 7 55886781 missense probably damaging 1.00
R0843:Cyfip1 UTSW 7 55922820 missense probably benign 0.24
R1666:Cyfip1 UTSW 7 55871898 missense probably damaging 0.99
R1789:Cyfip1 UTSW 7 55926395 missense probably damaging 1.00
R1817:Cyfip1 UTSW 7 55873448 missense possibly damaging 0.51
R1929:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2271:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2272:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2328:Cyfip1 UTSW 7 55894991 missense possibly damaging 0.87
R2518:Cyfip1 UTSW 7 55928284 missense probably damaging 1.00
R2963:Cyfip1 UTSW 7 55895035 missense probably damaging 0.99
R4271:Cyfip1 UTSW 7 55879101 missense probably benign 0.02
R4435:Cyfip1 UTSW 7 55900041 missense probably damaging 0.99
R4640:Cyfip1 UTSW 7 55913451 missense possibly damaging 0.92
R4676:Cyfip1 UTSW 7 55875013 missense probably damaging 0.99
R4887:Cyfip1 UTSW 7 55872068 missense probably damaging 1.00
R5085:Cyfip1 UTSW 7 55898335 missense probably benign 0.33
R5238:Cyfip1 UTSW 7 55892031 missense probably benign
R5244:Cyfip1 UTSW 7 55925199 missense probably damaging 1.00
R5288:Cyfip1 UTSW 7 55925135 missense possibly damaging 0.60
R5294:Cyfip1 UTSW 7 55873483 missense possibly damaging 0.88
R5552:Cyfip1 UTSW 7 55872107 missense possibly damaging 0.94
R5558:Cyfip1 UTSW 7 55892001 missense possibly damaging 0.71
R5667:Cyfip1 UTSW 7 55873730 missense probably benign 0.19
R5819:Cyfip1 UTSW 7 55879151 missense probably damaging 1.00
R5859:Cyfip1 UTSW 7 55925181 missense probably damaging 1.00
R5867:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5868:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5944:Cyfip1 UTSW 7 55872130 missense probably damaging 0.98
R6124:Cyfip1 UTSW 7 55897943 missense probably benign 0.12
R6131:Cyfip1 UTSW 7 55873480 missense possibly damaging 0.79
R6219:Cyfip1 UTSW 7 55908441 missense possibly damaging 0.52
R6243:Cyfip1 UTSW 7 55900529 missense probably damaging 1.00
R6669:Cyfip1 UTSW 7 55900061 missense probably damaging 0.99
R6869:Cyfip1 UTSW 7 55907365 missense possibly damaging 0.73
R7014:Cyfip1 UTSW 7 55919493 missense probably benign 0.34
R7224:Cyfip1 UTSW 7 55928189 frame shift probably null
R7225:Cyfip1 UTSW 7 55928189 frame shift probably null
R7305:Cyfip1 UTSW 7 55928189 frame shift probably null
R7336:Cyfip1 UTSW 7 55926400 missense possibly damaging 0.96
R7429:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7430:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7469:Cyfip1 UTSW 7 55877720 missense possibly damaging 0.91
R7568:Cyfip1 UTSW 7 55872249 splice site probably null
R7830:Cyfip1 UTSW 7 55873462 missense probably damaging 1.00
R7839:Cyfip1 UTSW 7 55886735 missense probably damaging 0.98
R7859:Cyfip1 UTSW 7 55900026 missense probably damaging 1.00
R7965:Cyfip1 UTSW 7 55896775 missense possibly damaging 0.78
R8176:Cyfip1 UTSW 7 55924427 missense probably benign 0.12
R8386:Cyfip1 UTSW 7 55877740 missense probably damaging 1.00
R8388:Cyfip1 UTSW 7 55872125 missense probably damaging 1.00
X0018:Cyfip1 UTSW 7 55900025 missense probably damaging 0.98
X0028:Cyfip1 UTSW 7 55907430 missense probably damaging 1.00
Z1088:Cyfip1 UTSW 7 55875052 missense probably damaging 0.99
Z1177:Cyfip1 UTSW 7 55898320 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTGCTCTATCAGGTAGGTCTTG -3'
(R):5'- TGGCAAAGAATTTCTCTGGGC -3'

Sequencing Primer
(F):5'- TGGGGCAGATGTGACGTAGC -3'
(R):5'- GGTGTCCTGGAACTCACTCTATAAG -3'
Posted On2020-10-20