Incidental Mutation 'R8444:Casc3'
ID 654396
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Name cancer susceptibility candidate 3
Synonyms Btz, Mln51
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock # R8444 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 98804905-98833814 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98822781 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 280 (R280C)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000169695]
AlphaFold Q8K3W3
Predicted Effect probably damaging
Transcript: ENSMUST00000017384
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169695
AA Change: R280C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R280C

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Aoc3 G T 11: 101,341,747 R466S unknown Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Cyfip1 A G 7: 55,872,154 M69V possibly damaging Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Hps6 T G 19: 46,005,428 S601R possibly damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Ighm A C 12: 113,421,193 S347A Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98823202 missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98823401 critical splice donor site probably null
IGL01901:Casc3 APN 11 98823121 missense probably damaging 1.00
IGL02345:Casc3 APN 11 98827564 splice site probably benign
IGL02875:Casc3 APN 11 98821552 missense probably damaging 1.00
IGL02964:Casc3 APN 11 98828923 missense probably damaging 0.96
R0147:Casc3 UTSW 11 98822499 missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98821493 missense probably damaging 0.99
R0763:Casc3 UTSW 11 98831318 missense probably damaging 1.00
R1581:Casc3 UTSW 11 98822818 missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98821506 missense probably benign 0.01
R4380:Casc3 UTSW 11 98823031 missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98822958 missense probably benign 0.13
R4988:Casc3 UTSW 11 98821874 splice site probably null
R5079:Casc3 UTSW 11 98810426 intron probably benign
R5442:Casc3 UTSW 11 98821471 missense probably damaging 0.99
R5511:Casc3 UTSW 11 98810914 nonsense probably null
R5873:Casc3 UTSW 11 98821444 missense unknown
R6041:Casc3 UTSW 11 98828559 missense probably damaging 1.00
R6685:Casc3 UTSW 11 98822530 missense probably damaging 0.99
R7030:Casc3 UTSW 11 98822533 missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98827587 missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98821485 missense probably benign 0.04
R7659:Casc3 UTSW 11 98809873 missense unknown
R7660:Casc3 UTSW 11 98809873 missense unknown
R8443:Casc3 UTSW 11 98822781 missense probably damaging 1.00
R8491:Casc3 UTSW 11 98823151 missense probably benign 0.27
R8516:Casc3 UTSW 11 98822781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTGGAACATCTCCCTGAC -3'
(R):5'- CGTGACCGGTAACTAGCTTCATG -3'

Sequencing Primer
(F):5'- GGAACATCTCCCTGACTCCTTTGG -3'
(R):5'- GCTTCATGCTTAAGAGTCTCAGCAG -3'
Posted On 2020-10-20