Incidental Mutation 'R8444:Aoc3'
ID654398
Institutional Source Beutler Lab
Gene Symbol Aoc3
Ensembl Gene ENSMUSG00000019326
Gene Nameamine oxidase, copper containing 3
Synonymssemicarbazide-sensitive amine oxidase, SSAO, VAP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R8444 (G1)
Quality Score181.009
Status Not validated
Chromosome11
Chromosomal Location101330605-101341938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101341747 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 466 (R466S)
Ref Sequence ENSEMBL: ENSMUSP00000017316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000103105]
Predicted Effect unknown
Transcript: ENSMUST00000017316
AA Change: R466S
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326
AA Change: R466S

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semicarbazide-sensitive amine oxidase family. Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes in the presence of copper and quinone cofactor. The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. Alterations in levels of the encoded protein may be associated with many diseases, including diabetes mellitus. A pseudogene of this gene has been described and is located approximately 9-kb downstream on the same chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null mice display decreased lymphocyte migration and homing in response to inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Cyfip1 A G 7: 55,872,154 M69V possibly damaging Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Hps6 T G 19: 46,005,428 S601R possibly damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Ighm A C 12: 113,421,193 S347A Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Aoc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Aoc3 APN 11 101337478 missense possibly damaging 0.73
IGL02026:Aoc3 APN 11 101337595 missense probably benign
IGL02500:Aoc3 APN 11 101337389 nonsense probably null
R0463:Aoc3 UTSW 11 101331606 missense probably damaging 1.00
R0524:Aoc3 UTSW 11 101337511 missense probably damaging 1.00
R0538:Aoc3 UTSW 11 101332138 missense possibly damaging 0.77
R0685:Aoc3 UTSW 11 101336447 missense possibly damaging 0.84
R0740:Aoc3 UTSW 11 101332332 missense probably benign 0.01
R0946:Aoc3 UTSW 11 101332305 missense possibly damaging 0.89
R1723:Aoc3 UTSW 11 101336435 missense possibly damaging 0.82
R1869:Aoc3 UTSW 11 101331467 nonsense probably null
R3735:Aoc3 UTSW 11 101332219 missense probably damaging 0.99
R4497:Aoc3 UTSW 11 101332045 missense possibly damaging 0.70
R4613:Aoc3 UTSW 11 101337659 intron probably benign
R4858:Aoc3 UTSW 11 101331662 missense probably damaging 1.00
R4954:Aoc3 UTSW 11 101332099 missense probably damaging 1.00
R4976:Aoc3 UTSW 11 101330974 missense probably damaging 1.00
R5770:Aoc3 UTSW 11 101331752 nonsense probably null
R6679:Aoc3 UTSW 11 101331453 missense probably damaging 1.00
R7485:Aoc3 UTSW 11 101337403 missense probably damaging 1.00
R7693:Aoc3 UTSW 11 101332512 missense probably benign 0.00
R7888:Aoc3 UTSW 11 101332497 missense probably damaging 1.00
R8041:Aoc3 UTSW 11 101332306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTTTAGGATGGAGGCC -3'
(R):5'- TCTGTGAAACTCTTTACTGCAAG -3'

Sequencing Primer
(F):5'- CCATGGAGGGATACTACTTACTGAC -3'
(R):5'- GTCTGGAACTGAACTTGG -3'
Posted On2020-10-20