Incidental Mutation 'R8444:Ighm'
ID654402
Institutional Source Beutler Lab
Gene Symbol Ighm
Ensembl Gene ENSMUSG00000076617
Gene Nameimmunoglobulin heavy constant mu
SynonymsmuH, IgM, Igh6, Igh-M, Ig mu
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8444 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location113418558-113422730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 113421193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 347 (S347A)
Gene Model predicted gene model for transcript(s):
Predicted Effect
SMART Domains Protein: ENSMUSP00000100222
Gene: ENSMUSG00000076617
AA Change: S347A

DomainStartEndE-ValueType
IG_like 23 99 1.94e-2 SMART
IGc1 131 209 2.37e-14 SMART
IG_like 241 315 1.6e-2 SMART
IGc1 348 425 1.94e-33 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192250
Predicted Effect probably benign
Transcript: ENSMUST00000194162
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Aoc3 G T 11: 101,341,747 R466S unknown Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Cyfip1 A G 7: 55,872,154 M69V possibly damaging Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Hps6 T G 19: 46,005,428 S601R possibly damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Ighm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Ighm APN 12 113421234 unclassified probably benign
IGL01775:Ighm APN 12 113422467 missense unknown
IGL02069:Ighm APN 12 113421148 unclassified probably benign
IGL03124:Ighm APN 12 113421638 missense unknown
manifest UTSW 12 113421253 nonsense probably null
R3055:Ighm UTSW 12 113418976 unclassified probably benign
R3056:Ighm UTSW 12 113418976 unclassified probably benign
R4164:Ighm UTSW 12 113422295 missense unknown
R4475:Ighm UTSW 12 113420893 unclassified probably benign
R4871:Ighm UTSW 12 113421621 missense unknown
R5542:Ighm UTSW 12 113418981 unclassified probably benign
R5738:Ighm UTSW 12 113421495 missense unknown
R5856:Ighm UTSW 12 113421602 missense unknown
R5946:Ighm UTSW 12 113422709 missense unknown
R6267:Ighm UTSW 12 113421567 missense unknown
R6296:Ighm UTSW 12 113421567 missense unknown
R7409:Ighm UTSW 12 113422232 missense
R7492:Ighm UTSW 12 113422673 missense
R7898:Ighm UTSW 12 113421253 nonsense probably null
R8089:Ighm UTSW 12 113421234 unclassified probably benign
R8301:Ighm UTSW 12 113421545 missense
Predicted Primers PCR Primer
(F):5'- CTGTCACAGTCAGGATGCTGTG -3'
(R):5'- TGTGACTCACAGGGATCTGC -3'

Sequencing Primer
(F):5'- TGCTGTGGGTAAAGTAGAAGCCTG -3'
(R):5'- GACTCACAGGGATCTGCCTTCAC -3'
Posted On2020-10-20