Incidental Mutation 'R8444:Hps6'
ID 654424
Institutional Source Beutler Lab
Gene Symbol Hps6
Ensembl Gene ENSMUSG00000074811
Gene Name HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms 5330434M19Rik, BLOC-2, ruby eye, ru
MMRRC Submission
Accession Numbers

MGI: 2181763

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8444 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 46003478-46006173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 46005428 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 601 (S601R)
Ref Sequence ENSEMBL: ENSMUSP00000096991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099393]
AlphaFold Q8BLY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099393
AA Change: S601R

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096991
Gene: ENSMUSG00000074811
AA Change: S601R

DomainStartEndE-ValueType
Pfam:HPS6 1 772 1e-281 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010K14Rik G T 11: 70,236,929 R56S possibly damaging Het
1700013F07Rik A G 3: 108,544,068 H115R probably benign Het
Abca14 T A 7: 120,318,910 I1545K probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Abcd2 A G 15: 91,174,636 V535A probably benign Het
Adcy9 T C 16: 4,288,623 T1113A probably damaging Het
Afdn A T 17: 13,883,800 N1133Y probably benign Het
Aip T A 19: 4,116,034 D139V probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Aldh16a1 G A 7: 45,149,691 P56S probably benign Het
Alpk3 A C 7: 81,057,720 T31P probably benign Het
Aoc3 G T 11: 101,341,747 R466S unknown Het
Atoh1 T C 6: 64,729,657 L112P probably benign Het
Atp2b2 T A 6: 113,793,811 N424I probably benign Het
Brms1 T C 19: 5,041,492 probably null Het
Casc3 C T 11: 98,822,781 R280C probably damaging Het
Cd34 T A 1: 194,958,500 S224R probably benign Het
Cdh20 T A 1: 104,970,858 F437I probably benign Het
Cdkal1 A T 13: 29,326,104 V557E probably benign Het
Chst5 T C 8: 111,890,763 H75R probably damaging Het
Col5a2 A T 1: 45,396,145 N713K probably benign Het
Cpne5 A T 17: 29,188,383 M181K probably benign Het
Cpt1a T C 19: 3,381,981 F731S probably benign Het
Cyfip1 A G 7: 55,872,154 M69V possibly damaging Het
Dennd3 A G 15: 73,570,823 K1232E probably benign Het
Dennd4b A T 3: 90,273,952 H805L probably benign Het
Dnm1l C T 16: 16,341,042 R108Q probably damaging Het
Dsc1 T A 18: 20,089,579 D612V probably benign Het
Ephb2 C T 4: 136,661,400 G628R probably damaging Het
Esrrb G A 12: 86,505,821 R195H probably benign Het
Flg2 A T 3: 93,200,278 E23D probably damaging Het
Gja8 A G 3: 96,919,674 L224P probably damaging Het
Ice1 T C 13: 70,604,376 E1197G probably damaging Het
Ifnar2 C A 16: 91,403,969 A366D possibly damaging Het
Ighm A C 12: 113,421,193 S347A Het
Immt C T 6: 71,871,508 R494* probably null Het
Irs2 A G 8: 11,006,683 V583A probably damaging Het
Kcnk4 T C 19: 6,926,140 E347G probably damaging Het
Kif5b T A 18: 6,213,245 I716F probably benign Het
Klhl1 T A 14: 96,517,890 D143V probably benign Het
Lrp1b T C 2: 40,870,260 T2999A Het
Map3k9 A G 12: 81,722,196 L1026P probably damaging Het
Mtg1 T C 7: 140,138,370 V54A probably damaging Het
Mx1 G T 16: 97,451,487 C231* probably null Het
Olfr1129 G A 2: 87,575,739 M218I probably benign Het
Olfr478 C A 7: 108,031,863 W160L probably benign Het
Olfr507 A G 7: 108,621,820 I3V probably benign Het
Olfr680-ps1 A G 7: 105,090,958 V227A probably damaging Het
Olfr808 T A 10: 129,767,925 V143E probably damaging Het
Otogl T A 10: 107,857,114 E836D probably benign Het
Pde6d A G 1: 86,543,528 S143P probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Pon1 C T 6: 5,177,327 W194* probably null Het
Rbm25 T A 12: 83,664,251 S379R unknown Het
Rnf111 A T 9: 70,457,941 S415T probably benign Het
Shoc2 A G 19: 53,988,072 Y131C probably damaging Het
Slc17a2 A T 13: 23,819,078 H237L probably benign Het
Slc23a1 T A 18: 35,624,436 M261L possibly damaging Het
Slc35d1 G C 4: 103,214,699 I35M Het
Slc8b1 C T 5: 120,513,138 probably benign Het
Smr3a A C 5: 88,004,752 L8F unknown Het
Snx8 G A 5: 140,358,174 R96C possibly damaging Het
Srgap3 A G 6: 112,775,548 V325A possibly damaging Het
Stk40 A G 4: 126,118,334 T10A probably benign Het
Tmem177 A T 1: 119,910,220 V243D probably benign Het
Trim6 G A 7: 104,232,672 V403M probably damaging Het
Ttc25 G T 11: 100,561,905 probably null Het
Tysnd1 A G 10: 61,696,171 R201G probably benign Het
Vmn2r67 A T 7: 85,136,646 F717Y probably benign Het
Vmn2r72 A G 7: 85,738,175 V727A probably benign Het
Wdr49 A C 3: 75,451,690 D43E probably benign Het
Zbtb8b A G 4: 129,432,631 V247A probably benign Het
Zfp532 C A 18: 65,624,259 A421E possibly damaging Het
Other mutations in Hps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hps6 APN 19 46003660 missense probably damaging 1.00
IGL02826:Hps6 APN 19 46006041 makesense probably null
stamper-coat UTSW 19 46003836 missense probably damaging 1.00
R0299:Hps6 UTSW 19 46004232 missense probably damaging 0.98
R0613:Hps6 UTSW 19 46003821 missense probably benign
R1036:Hps6 UTSW 19 46004241 missense probably benign 0.00
R1845:Hps6 UTSW 19 46004970 missense probably benign 0.30
R1959:Hps6 UTSW 19 46004335 missense probably benign 0.33
R2271:Hps6 UTSW 19 46005682 missense possibly damaging 0.86
R2332:Hps6 UTSW 19 46004491 missense possibly damaging 0.82
R3156:Hps6 UTSW 19 46003741 missense probably damaging 1.00
R3937:Hps6 UTSW 19 46004053 missense probably damaging 0.97
R7108:Hps6 UTSW 19 46005490 missense probably damaging 1.00
R7384:Hps6 UTSW 19 46004017 missense possibly damaging 0.96
R7710:Hps6 UTSW 19 46004568 missense probably benign 0.03
R8530:Hps6 UTSW 19 46003520 start gained probably benign
R8773:Hps6 UTSW 19 46005702 missense possibly damaging 0.92
R8868:Hps6 UTSW 19 46004007 missense possibly damaging 0.89
R9329:Hps6 UTSW 19 46004103 missense probably benign 0.00
R9385:Hps6 UTSW 19 46005910 missense probably damaging 0.97
X0065:Hps6 UTSW 19 46004166 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCGGATGTATGGAAGAAGGTCC -3'
(R):5'- AGCAGCTTAAAGATCTCACTTCGAAG -3'

Sequencing Primer
(F):5'- GAAGGTCCTAAGGGCTCCAAC -3'
(R):5'- CTTAAAGATCTCACTTCGAAGCAGGG -3'
Posted On 2020-10-20