Incidental Mutation 'R8445:Slc30a7'
ID 654434
Institutional Source Beutler Lab
Gene Symbol Slc30a7
Ensembl Gene ENSMUSG00000054414
Gene Name solute carrier family 30 (zinc transporter), member 7
Synonyms 2610034N15Rik, 4833428C12Rik, 1810059J10Rik, ZnT-7, ZnT7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock # R8445 (G1)
Quality Score 191.009
Status Not validated
Chromosome 3
Chromosomal Location 115938973-116007406 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 116007346 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029575] [ENSMUST00000067485] [ENSMUST00000106501] [ENSMUST00000106502]
AlphaFold Q9JKN1
Predicted Effect probably benign
Transcript: ENSMUST00000029575
SMART Domains Protein: ENSMUSP00000029575
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 8.5e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067485
SMART Domains Protein: ENSMUSP00000065254
Gene: ENSMUSG00000054414

DomainStartEndE-ValueType
Pfam:Cation_efflux 38 296 3.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106501
SMART Domains Protein: ENSMUSP00000102110
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_transf_64 53 307 1.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106502
SMART Domains Protein: ENSMUSP00000102111
Gene: ENSMUSG00000027963

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 1.4e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc functions as a cofactor for numerous enzymes, nuclear factors, and hormones and as an intra- and intercellular signal ion. Members of the zinc transporter (ZNT)/SLC30 subfamily of the cation diffusion facilitator family, such as SLC30A7, permit cellular efflux of zinc (Seve et al., 2004 [PubMed 15154973]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit a low body zinc status, reduced food intake and poor body weight gain, and are lean due to a significant reduction in body fat accumulation; however, no signs of hair growth abnormalities or dermatitis are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Slc30a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Slc30a7 APN 3 115946720 splice site probably null
IGL01161:Slc30a7 APN 3 115954110 missense possibly damaging 0.54
IGL01360:Slc30a7 APN 3 115990116 missense probably damaging 1.00
IGL02573:Slc30a7 APN 3 115990147 splice site probably benign
R0833:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R0836:Slc30a7 UTSW 3 115990140 critical splice acceptor site probably null
R1381:Slc30a7 UTSW 3 115956870 critical splice donor site probably null
R2445:Slc30a7 UTSW 3 115978653 missense probably damaging 1.00
R4072:Slc30a7 UTSW 3 115946680 missense probably damaging 0.96
R4850:Slc30a7 UTSW 3 115993008 missense probably damaging 0.99
R5429:Slc30a7 UTSW 3 116006925 missense possibly damaging 0.90
R5586:Slc30a7 UTSW 3 115990051 missense probably benign 0.36
R6170:Slc30a7 UTSW 3 115990743 missense probably damaging 1.00
R6813:Slc30a7 UTSW 3 115981811 missense probably benign 0.01
R6889:Slc30a7 UTSW 3 115954153 missense probably damaging 1.00
R8872:Slc30a7 UTSW 3 115946668 missense possibly damaging 0.69
X0023:Slc30a7 UTSW 3 115990025 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCCGAACAGATTGAACTTG -3'
(R):5'- AGTTCAGGAGATAGGACCCCTAG -3'

Sequencing Primer
(F):5'- CCGAACAGATTGAACTTGGGTGG -3'
(R):5'- GATAGGACCCCTAGCTCAGC -3'
Posted On 2020-10-20