Incidental Mutation 'R8445:Fbxl4'
ID 654436
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene Name F-box and leucine-rich repeat protein 4
Synonyms FBL5, FBL4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.455) question?
Stock # R8445 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 22357543-22434091 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 22385983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 197 (Q197K)
Ref Sequence ENSEMBL: ENSMUSP00000042219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
AlphaFold Q8BH70
Predicted Effect probably benign
Transcript: ENSMUST00000039234
AA Change: Q197K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: Q197K

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
AA Change: Q197K

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000184582
AA Change: Q197K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: Q197K

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185029
AA Change: Q197K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410
AA Change: Q197K

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1053:Fbxl4 UTSW 4 22427166 missense probably benign
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 splice site probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
R7106:Fbxl4 UTSW 4 22427140 splice site probably null
R7164:Fbxl4 UTSW 4 22386218 missense probably benign 0.00
R7264:Fbxl4 UTSW 4 22386145 missense possibly damaging 0.94
R7502:Fbxl4 UTSW 4 22376655 missense probably benign
R7645:Fbxl4 UTSW 4 22377037 missense probably damaging 1.00
R7666:Fbxl4 UTSW 4 22376869 missense probably benign 0.07
R8152:Fbxl4 UTSW 4 22427225 missense possibly damaging 0.77
R8693:Fbxl4 UTSW 4 22403704 missense probably benign
R8856:Fbxl4 UTSW 4 22390803 missense probably damaging 1.00
R9334:Fbxl4 UTSW 4 22376778 missense probably damaging 0.99
Z1176:Fbxl4 UTSW 4 22427280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAATATTCTGGAAGTGAGTCTGGTG -3'
(R):5'- ATTATGTGGCCCATCCCCAAG -3'

Sequencing Primer
(F):5'- GGTTCTTTTCACCTTATTTGGTCAC -3'
(R):5'- TTGTTAAGAGCATCCATCTCACAGC -3'
Posted On 2020-10-20