Incidental Mutation 'R8445:Vmn2r26'
ID 654443
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8445 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124026036 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 135 (N135S)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: N135S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: N135S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- ATTAAGCCGTCCTATACCTCTTCAG -3'

Sequencing Primer
(F):5'- TCCAAAATTTGAGAGGGAGCACTG -3'
(R):5'- AGCCGTCCTATACCTCTTCAGTAAAC -3'
Posted On 2020-10-20