Incidental Mutation 'R8445:Nlrp4e'
ID654448
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene NameNLR family, pyrin domain containing 4E
Synonyms4930406H16Rik, Nalp4e, Nalp-epsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8445 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23301192-23362277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23340540 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 763 (I763L)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
Predicted Effect probably benign
Transcript: ENSMUST00000076470
AA Change: I763L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: I763L

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTCAAACCTTCATGGGAATAGCAAG -3'
(R):5'- CTTGAGCTCTAAGACCCACC -3'

Sequencing Primer
(F):5'- TTCATGGGAATAGCAAGGAAAAATTG -3'
(R):5'- CAGCTCTGTGGTTGCAGACATC -3'
Posted On2020-10-20