Incidental Mutation 'R8445:Rbpms2'
ID 654455
Institutional Source Beutler Lab
Gene Symbol Rbpms2
Ensembl Gene ENSMUSG00000032387
Gene Name RNA binding protein with multiple splicing 2
Synonyms 2400008B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8445 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 65629648-65660528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65651021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 113 (A113V)
Ref Sequence ENSEMBL: ENSMUSP00000057600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055844] [ENSMUST00000169003] [ENSMUST00000216342] [ENSMUST00000216382]
AlphaFold Q8VC52
Predicted Effect possibly damaging
Transcript: ENSMUST00000055844
AA Change: A113V

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057600
Gene: ENSMUSG00000032387
AA Change: A113V

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 172 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169003
AA Change: A113V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131076
Gene: ENSMUSG00000032387
AA Change: A113V

DomainStartEndE-ValueType
RRM 26 98 7.84e-8 SMART
low complexity region 135 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216342
AA Change: A123V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216382
AA Change: A141V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the RNA recognition motif (RRM)-containing protein family and is involved in the development and dedifferentiation of digestive smooth muscle cells. The encoded protein functions as a homodimer and indirectly inhibits the bone morphogenetic protein pathway. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Rbpms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0018:Rbpms2 UTSW 9 65651078 missense probably damaging 1.00
R0567:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0568:Rbpms2 UTSW 9 65651666 unclassified probably benign
R0570:Rbpms2 UTSW 9 65659194 nonsense probably null
R0727:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1374:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1375:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1377:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1390:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1412:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1662:Rbpms2 UTSW 9 65651042 missense probably benign 0.05
R1710:Rbpms2 UTSW 9 65659212 splice site probably benign
R1714:Rbpms2 UTSW 9 65651665 unclassified probably benign
R1714:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1715:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1838:Rbpms2 UTSW 9 65651680 unclassified probably benign
R1839:Rbpms2 UTSW 9 65651666 unclassified probably benign
R1882:Rbpms2 UTSW 9 65651666 unclassified probably benign
R2088:Rbpms2 UTSW 9 65630839 missense probably damaging 0.99
R2118:Rbpms2 UTSW 9 65650947 missense probably damaging 1.00
R2237:Rbpms2 UTSW 9 65651611 nonsense probably null
R4633:Rbpms2 UTSW 9 65651636 missense probably benign 0.02
R7249:Rbpms2 UTSW 9 65649350 missense probably damaging 1.00
R8277:Rbpms2 UTSW 9 65649413 missense probably damaging 1.00
R8902:Rbpms2 UTSW 9 65651069 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCCACTGTAGCCCTTTGTGG -3'
(R):5'- GCTATGGGTGAAAGAAAGTCCC -3'

Sequencing Primer
(F):5'- CCACTGTAGCCCTTTGTGGAAAAG -3'
(R):5'- GTCCCAGAAAAGGAGATATGACCC -3'
Posted On 2020-10-20