Incidental Mutation 'R8445:Wdr89'
ID654463
Institutional Source Beutler Lab
Gene Symbol Wdr89
Ensembl Gene ENSMUSG00000045690
Gene NameWD repeat domain 89
Synonyms2600001A11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8445 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location75630596-75669537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75632862 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 206 (D206G)
Ref Sequence ENSEMBL: ENSMUSP00000050532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062370] [ENSMUST00000187307]
Predicted Effect probably damaging
Transcript: ENSMUST00000062370
AA Change: D206G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050532
Gene: ENSMUSG00000045690
AA Change: D206G

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187307
AA Change: D206G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140172
Gene: ENSMUSG00000045690
AA Change: D206G

DomainStartEndE-ValueType
WD40 20 56 3.82e1 SMART
WD40 59 98 1.85e-3 SMART
WD40 103 147 2.64e2 SMART
WD40 157 198 6.38e-7 SMART
WD40 205 244 1.1e2 SMART
WD40 308 348 1.82e-2 SMART
low complexity region 366 379 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Wdr89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Wdr89 APN 12 75633051 nonsense probably null
IGL02176:Wdr89 APN 12 75633123 missense probably damaging 0.96
IGL02472:Wdr89 APN 12 75632969 missense probably damaging 1.00
IGL02973:Wdr89 APN 12 75633099 missense probably damaging 0.98
R0003:Wdr89 UTSW 12 75632593 missense probably benign 0.00
R2060:Wdr89 UTSW 12 75632988 missense probably damaging 1.00
R4494:Wdr89 UTSW 12 75632747 missense probably damaging 1.00
R5120:Wdr89 UTSW 12 75632638 missense probably damaging 1.00
R5195:Wdr89 UTSW 12 75633288 missense probably benign 0.23
R6572:Wdr89 UTSW 12 75633385 missense probably damaging 1.00
R7487:Wdr89 UTSW 12 75632614 missense probably benign
R7835:Wdr89 UTSW 12 75632899 missense probably damaging 1.00
R8765:Wdr89 UTSW 12 75632914 missense probably damaging 1.00
X0023:Wdr89 UTSW 12 75633177 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATACAGGCCACCAATCAG -3'
(R):5'- AGGTTCACATCTCAGGATCTGTC -3'

Sequencing Primer
(F):5'- AGATAGTCCAAGTGCCCATCTTTCAC -3'
(R):5'- ACATCTCAGGATCTGTCGACGAG -3'
Posted On2020-10-20