Incidental Mutation 'R8445:Zfp623'
ID 654468
Institutional Source Beutler Lab
Gene Symbol Zfp623
Ensembl Gene ENSMUSG00000050846
Gene Name zinc finger protein 623
Synonyms 2610029D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock # R8445 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 75940952-75949400 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 75947553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 119 (Y119*)
Ref Sequence ENSEMBL: ENSMUSP00000036049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037260]
AlphaFold Q9CY99
Predicted Effect probably null
Transcript: ENSMUST00000037260
AA Change: Y119*
SMART Domains Protein: ENSMUSP00000036049
Gene: ENSMUSG00000050846
AA Change: Y119*

DomainStartEndE-ValueType
ZnF_C2H2 119 141 5.59e-4 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
ZnF_C2H2 175 197 2.4e-3 SMART
ZnF_C2H2 203 225 6.42e-4 SMART
ZnF_C2H2 231 253 1.3e-4 SMART
ZnF_C2H2 259 281 1.3e-4 SMART
ZnF_C2H2 287 309 1.28e-3 SMART
ZnF_C2H2 315 337 3.21e-4 SMART
ZnF_C2H2 343 365 3.39e-3 SMART
ZnF_C2H2 371 393 4.87e-4 SMART
ZnF_C2H2 399 421 2.53e-2 SMART
ZnF_C2H2 427 449 3.95e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zfp952 T G 17: 33,003,578 F344V possibly damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Zfp623
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Zfp623 APN 15 75948203 missense probably damaging 1.00
IGL01524:Zfp623 APN 15 75947679 missense probably benign
IGL01927:Zfp623 APN 15 75947505 missense possibly damaging 0.57
IGL03199:Zfp623 APN 15 75947270 missense probably benign 0.40
R0076:Zfp623 UTSW 15 75947209 missense probably benign
R0352:Zfp623 UTSW 15 75948584 missense probably benign 0.00
R0360:Zfp623 UTSW 15 75948661 missense probably benign
R0364:Zfp623 UTSW 15 75948661 missense probably benign
R1783:Zfp623 UTSW 15 75947911 missense probably damaging 0.99
R2219:Zfp623 UTSW 15 75947530 missense possibly damaging 0.90
R5975:Zfp623 UTSW 15 75948163 missense probably benign 0.43
R6161:Zfp623 UTSW 15 75948621 missense probably benign 0.22
R6342:Zfp623 UTSW 15 75947988 nonsense probably null
R6490:Zfp623 UTSW 15 75948459 missense probably damaging 1.00
R6513:Zfp623 UTSW 15 75947468 missense probably benign
R7028:Zfp623 UTSW 15 75948305 missense probably damaging 0.99
R7399:Zfp623 UTSW 15 75947398 missense probably damaging 0.98
R7716:Zfp623 UTSW 15 75948422 missense probably damaging 1.00
R8362:Zfp623 UTSW 15 75947639 missense probably damaging 1.00
R9028:Zfp623 UTSW 15 75947500 missense probably damaging 0.97
R9035:Zfp623 UTSW 15 75948313 missense possibly damaging 0.93
R9310:Zfp623 UTSW 15 75948100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCACTCAGATGACAGTGACC -3'
(R):5'- TGCACACTTGAACGGCTTTTC -3'

Sequencing Primer
(F):5'- GTGACCCACTGGAAGATTCAAACAG -3'
(R):5'- GAACGGCTTTTCCCCAGTATGG -3'
Posted On 2020-10-20