Incidental Mutation 'R8445:Zfp952'
ID654471
Institutional Source Beutler Lab
Gene Symbol Zfp952
Ensembl Gene ENSMUSG00000053390
Gene Namezinc finger protein 952
SynonymsC920016K16Rik
Accession Numbers

Genbank: NM_001045559; MGI: 2441928

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8445 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32993129-33005457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33003578 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 344 (F344V)
Ref Sequence ENSEMBL: ENSMUSP00000084949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087666] [ENSMUST00000157017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087666
AA Change: F344V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000084949
Gene: ENSMUSG00000053390
AA Change: F344V

DomainStartEndE-ValueType
KRAB 10 73 4.6e-14 SMART
ZnF_C2H2 251 273 3.44e-4 SMART
ZnF_C2H2 279 301 1.28e-3 SMART
ZnF_C2H2 307 329 1.36e-2 SMART
ZnF_C2H2 335 357 2.75e-3 SMART
ZnF_C2H2 363 385 9.44e-2 SMART
ZnF_C2H2 391 413 1.47e-3 SMART
ZnF_C2H2 419 441 2.91e-2 SMART
ZnF_C2H2 447 469 2.57e-3 SMART
ZnF_C2H2 475 497 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157017
SMART Domains Protein: ENSMUSP00000123066
Gene: ENSMUSG00000053390

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-17 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 T G 9: 70,766,921 S522A probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alg12 C T 15: 88,814,486 R212Q probably benign Het
C330018D20Rik G A 18: 56,957,890 P67L probably damaging Het
Col3a1 C T 1: 45,341,180 R955* probably null Het
Cyp2j12 T A 4: 96,133,022 I116F possibly damaging Het
Cyp4a10 T A 4: 115,525,594 W331R probably damaging Het
Dmbt1 T A 7: 131,090,380 Y959N unknown Het
Dytn T A 1: 63,647,514 K332N probably benign Het
E130308A19Rik T A 4: 59,720,526 V686D probably damaging Het
Epha8 T C 4: 136,932,289 Y792C probably benign Het
Fam53c T C 18: 34,768,315 V95A probably benign Het
Fbxl4 C A 4: 22,385,983 Q197K probably benign Het
Fmod G A 1: 134,040,998 V259I probably benign Het
Insrr T C 3: 87,813,584 S1050P probably damaging Het
Itga4 A G 2: 79,281,781 M347V probably benign Het
Kdm5d A G Y: 916,874 E423G probably damaging Het
Klra7 A T 6: 130,227,115 I147N possibly damaging Het
Lbx1 T A 19: 45,234,212 K124I probably damaging Het
Map4k5 T A 12: 69,850,967 H138L probably damaging Het
Mc3r A G 2: 172,249,317 H153R probably damaging Het
Myh15 C A 16: 49,120,018 T777N probably damaging Het
Nfatc4 A C 14: 55,826,418 I121L possibly damaging Het
Nipa1 A T 7: 55,979,718 S216T probably benign Het
Nlrp4e A T 7: 23,340,540 I763L probably benign Het
Nop2 A G 6: 125,134,604 D100G probably benign Het
Olfr437 A G 6: 43,167,297 M80V probably benign Het
Olfr870 T A 9: 20,171,098 I158L probably benign Het
Prelid3a A G 18: 67,473,778 E80G probably damaging Het
Prl4a1 T C 13: 28,021,462 S137P possibly damaging Het
Rbpms2 C T 9: 65,651,021 A113V possibly damaging Het
Rph3a T C 5: 120,973,370 E49G probably damaging Het
Shisa7 A T 7: 4,836,353 M124K probably benign Het
Shprh C T 10: 11,181,569 P1078S possibly damaging Het
Slc30a7 C T 3: 116,007,346 probably benign Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Smg1 A C 7: 118,136,977 N3563K possibly damaging Het
Spata31d1c G T 13: 65,033,177 S30I probably damaging Het
St6galnac6 A G 2: 32,608,520 probably benign Het
Tcp11l1 C A 2: 104,681,933 E451D probably benign Het
Tfpt G A 7: 3,620,929 P160S probably damaging Het
Thbs4 C A 13: 92,790,841 A47S probably benign Het
Trpm2 T C 10: 77,910,252 D1482G probably damaging Het
Tspyl4 C T 10: 34,297,746 A78V probably benign Het
Vmn2r26 A G 6: 124,026,036 N135S probably damaging Het
Vmn2r87 A T 10: 130,477,466 V477E probably damaging Het
Wdr89 T C 12: 75,632,862 D206G probably damaging Het
Zfp623 C A 15: 75,947,553 Y119* probably null Het
Zfp879 A G 11: 50,833,386 M281T probably damaging Het
Zgrf1 T C 3: 127,586,205 probably null Het
Other mutations in Zfp952
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01865:Zfp952 APN 17 33002817 missense probably benign 0.00
IGL02560:Zfp952 APN 17 33002819 nonsense probably null
IGL03056:Zfp952 APN 17 33002766 missense probably damaging 0.98
IGL03151:Zfp952 APN 17 33003008 missense probably benign 0.01
0152:Zfp952 UTSW 17 33003221 splice site probably null
R0508:Zfp952 UTSW 17 33003005 missense possibly damaging 0.90
R1936:Zfp952 UTSW 17 33003669 missense possibly damaging 0.71
R3882:Zfp952 UTSW 17 33001975 nonsense probably null
R4560:Zfp952 UTSW 17 33003954 missense probably benign 0.33
R4649:Zfp952 UTSW 17 33002925 missense probably damaging 0.99
R7103:Zfp952 UTSW 17 33003632 missense possibly damaging 0.94
R7207:Zfp952 UTSW 17 33003515 missense possibly damaging 0.93
R7209:Zfp952 UTSW 17 33003470 missense possibly damaging 0.71
R7508:Zfp952 UTSW 17 33003782 missense probably benign 0.06
R7699:Zfp952 UTSW 17 33002009 missense possibly damaging 0.53
R8424:Zfp952 UTSW 17 33003217 missense probably benign 0.18
Z1177:Zfp952 UTSW 17 33003104 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTAATTCTGACCGGTATTGTGA -3'
(R):5'- GGCTTCAGTTCTACCCACTGG -3'

Sequencing Primer
(F):5'- GGGAAGGCATTCAGATATTCCTC -3'
(R):5'- CTGGATGAAGGCTTTCCCACAATG -3'
Posted On2020-10-20