Incidental Mutation 'R8446:Clca3a1'
ID 654485
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R8446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144729677-144760977 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144748487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 461 (Y461N)
Ref Sequence ENSEMBL: ENSMUSP00000054526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect probably benign
Transcript: ENSMUST00000029932
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059091
AA Change: Y461N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: Y461N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Csgalnact1 A G 8: 68,461,091 V154A probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb2l G T 16: 96,432,657 Q278K probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Lnx2 A G 5: 147,033,359 L191S probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr137 A G 17: 38,304,747 V238A probably benign Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Zfp763 A T 17: 33,019,499 M224K probably benign Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
R7638:Clca3a1 UTSW 3 144751962 missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144737036 missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144749731 missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144757962 missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144730818 missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144749685 missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144759166 splice site probably benign
R8416:Clca3a1 UTSW 3 144755153 critical splice donor site probably null
R8496:Clca3a1 UTSW 3 144747421 makesense probably null
R9014:Clca3a1 UTSW 3 144736970 missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144758034 missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144747549 missense probably benign 0.27
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGGAAAAGGTAACCACATTTTG -3'
(R):5'- CTCATCTTCTGTGGAGTTTAAACAG -3'

Sequencing Primer
(F):5'- AGGTAACCACATTTTGTATGACTTC -3'
(R):5'- AAGGTTCACAGCCTGAGTTC -3'
Posted On 2020-10-20