Incidental Mutation 'R8446:Lnx2'
ID 654495
Institutional Source Beutler Lab
Gene Symbol Lnx2
Ensembl Gene ENSMUSG00000016520
Gene Name ligand of numb-protein X 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147016655-147076586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 147033359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 191 (L191S)
Ref Sequence ENSEMBL: ENSMUSP00000016664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016664]
AlphaFold Q91XL2
Predicted Effect probably benign
Transcript: ENSMUST00000016664
AA Change: L191S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: L191S

DomainStartEndE-ValueType
RING 51 88 2.06e-6 SMART
low complexity region 103 114 N/A INTRINSIC
PDZ 242 317 2.25e-17 SMART
PDZ 348 421 2.97e-17 SMART
PDZ 474 553 7.37e-13 SMART
PDZ 606 683 1.27e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clca3a1 A T 3: 144,748,487 Y461N probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Csgalnact1 A G 8: 68,461,091 V154A probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb2l G T 16: 96,432,657 Q278K probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr137 A G 17: 38,304,747 V238A probably benign Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Zfp763 A T 17: 33,019,499 M224K probably benign Het
Other mutations in Lnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Lnx2 APN 5 147033015 missense possibly damaging 0.81
IGL02657:Lnx2 APN 5 147028174 missense probably damaging 1.00
IGL02820:Lnx2 APN 5 147042067 missense probably damaging 0.98
R0051:Lnx2 UTSW 5 147029353 missense probably damaging 0.96
R0389:Lnx2 UTSW 5 147019040 missense possibly damaging 0.51
R0482:Lnx2 UTSW 5 147018961 missense probably damaging 0.99
R1601:Lnx2 UTSW 5 147033519 missense probably damaging 0.99
R1604:Lnx2 UTSW 5 147029325 missense probably benign 0.02
R1647:Lnx2 UTSW 5 147027342 missense probably benign 0.04
R3001:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R3002:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R4734:Lnx2 UTSW 5 147029137 missense probably damaging 1.00
R4960:Lnx2 UTSW 5 147019040 missense probably benign 0.09
R5387:Lnx2 UTSW 5 147028154 missense probably benign 0.00
R5689:Lnx2 UTSW 5 147029151 missense probably damaging 1.00
R5950:Lnx2 UTSW 5 147024350 critical splice donor site probably null
R6161:Lnx2 UTSW 5 147042026 splice site probably null
R6623:Lnx2 UTSW 5 147024487 missense probably damaging 1.00
R7086:Lnx2 UTSW 5 147020178 splice site probably null
R7320:Lnx2 UTSW 5 147020133 missense possibly damaging 0.71
R7701:Lnx2 UTSW 5 147024523 missense probably damaging 1.00
R7887:Lnx2 UTSW 5 147019043 missense probably damaging 1.00
R8153:Lnx2 UTSW 5 147028096 missense probably benign
R8267:Lnx2 UTSW 5 147029091 missense probably damaging 1.00
R8298:Lnx2 UTSW 5 147024517 missense probably benign 0.05
R8384:Lnx2 UTSW 5 147029328 missense probably benign 0.01
R8971:Lnx2 UTSW 5 147033426 missense probably benign
R9378:Lnx2 UTSW 5 147024370 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTCTCCAGCTCAACACAGGG -3'
(R):5'- CTTTCTAGGTGTCCTGGAGC -3'

Sequencing Primer
(F):5'- ACTCCAGTGCAACTGTCTGGAC -3'
(R):5'- TAGGTGTCCTGGAGCCTCTCAC -3'
Posted On 2020-10-20