Incidental Mutation 'R8446:Csgalnact1'
ID 654501
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 68356781-68735146 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68461091 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 154 (V154A)
Ref Sequence ENSEMBL: ENSMUSP00000077459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]
AlphaFold Q8BJQ9
Predicted Effect probably damaging
Transcript: ENSMUST00000078350
AA Change: V154A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: V154A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130214
AA Change: V154A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: V154A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136060
AA Change: V154A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: V154A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 66 300 1.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clca3a1 A T 3: 144,748,487 Y461N probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb2l G T 16: 96,432,657 Q278K probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Lnx2 A G 5: 147,033,359 L191S probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr137 A G 17: 38,304,747 V238A probably benign Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Zfp763 A T 17: 33,019,499 M224K probably benign Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461109 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8519:Csgalnact1 UTSW 8 68401453 missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68358655 missense probably damaging 1.00
R9210:Csgalnact1 UTSW 8 68461589 start gained probably benign
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCTTCTATGAAGTCTGCAGC -3'
(R):5'- CTCAGCTAAAGGATGAACTGCAG -3'

Sequencing Primer
(F):5'- AGTCTGCAGCTGTGTAAGGAC -3'
(R):5'- AGTGAGCAGTTCCGCAGTG -3'
Posted On 2020-10-20