Incidental Mutation 'R8446:Triobp'
ID 654513
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene Name TRIO and F-actin binding protein
Synonyms EST478828, Mus EST 478828, Tara
MMRRC Submission 067827-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8446 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 78831924-78890069 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78878326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1750 (H1750Y)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]
AlphaFold Q99KW3
Predicted Effect possibly damaging
Transcript: ENSMUST00000109687
AA Change: H363Y

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: H363Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: H1704Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: H1704Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109690
AA Change: H1750Y

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: H1750Y

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088
AA Change: H358Y

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144151
SMART Domains Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
PH 1 92 1.04e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229270
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,771,641 (GRCm39) R529* probably null Het
Afap1 T A 5: 36,144,645 (GRCm39) S122T Het
Arnt TG T 3: 95,382,014 (GRCm39) probably null Het
Bbs1 G A 19: 4,947,633 (GRCm39) T307I probably benign Het
Cacna1c A T 6: 118,604,411 (GRCm39) S1439T Het
Camk4 T A 18: 33,289,810 (GRCm39) H152Q probably damaging Het
Capn2 A T 1: 182,311,796 (GRCm39) M426K possibly damaging Het
Chrm3 C T 13: 9,928,338 (GRCm39) G233S probably damaging Het
Clca3a1 A T 3: 144,454,248 (GRCm39) Y461N probably damaging Het
Clip1 G C 5: 123,794,008 (GRCm39) P12A probably damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Commd5 T C 15: 76,785,094 (GRCm39) S164P probably damaging Het
Csgalnact1 A G 8: 68,913,743 (GRCm39) V154A probably damaging Het
Ddias C A 7: 92,515,818 (GRCm39) C25F probably damaging Het
Dnah7b A T 1: 46,329,875 (GRCm39) I3240F probably damaging Het
Fam186a T G 15: 99,845,335 (GRCm39) D303A unknown Het
Igkv8-27 A G 6: 70,148,932 (GRCm39) I74T probably damaging Het
Itgb2l G T 16: 96,233,857 (GRCm39) Q278K probably damaging Het
Itgb7 T C 15: 102,127,043 (GRCm39) E464G probably damaging Het
Kdm2a G A 19: 4,406,916 (GRCm39) Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 141,728,845 (GRCm39) probably benign Het
Larp1 T C 11: 57,942,035 (GRCm39) probably null Het
Lnx2 A G 5: 146,970,169 (GRCm39) L191S probably benign Het
Mtmr7 G A 8: 41,059,927 (GRCm39) A62V possibly damaging Het
Myh4 T A 11: 67,144,347 (GRCm39) M1239K probably benign Het
Nckap5l C A 15: 99,323,930 (GRCm39) G858C probably benign Het
Nelfa A T 5: 34,058,982 (GRCm39) L262Q probably damaging Het
Or2j3 A G 17: 38,615,638 (GRCm39) V238A probably benign Het
Or8b46 A T 9: 38,450,964 (GRCm39) M258L probably benign Het
Pdgfa T C 5: 138,964,395 (GRCm39) T211A unknown Het
Prl3d2 A T 13: 27,307,976 (GRCm39) I86F probably benign Het
Rpf2 T A 10: 40,115,752 (GRCm39) T76S probably benign Het
Setbp1 C T 18: 78,900,971 (GRCm39) D899N probably damaging Het
Slc35c1 T A 2: 92,284,707 (GRCm39) E315D probably benign Het
Slc6a3 A T 13: 73,719,674 (GRCm39) M568L possibly damaging Het
Sorbs1 T C 19: 40,314,602 (GRCm39) M737V probably benign Het
Sox17 A G 1: 4,562,316 (GRCm39) Y295H possibly damaging Het
Tex44 A T 1: 86,354,696 (GRCm39) I202F possibly damaging Het
Tinagl1 C T 4: 130,060,694 (GRCm39) probably null Het
Tlr4 T A 4: 66,757,673 (GRCm39) N155K probably damaging Het
Tmem245 T C 4: 56,906,261 (GRCm39) Q548R probably benign Het
Topbp1 T A 9: 103,186,061 (GRCm39) F68I probably damaging Het
Trim67 G T 8: 125,520,730 (GRCm39) A31S probably damaging Het
Ttn A C 2: 76,778,553 (GRCm39) M1316R unknown Het
Usp40 T C 1: 87,906,190 (GRCm39) T682A probably benign Het
Wfs1 A T 5: 37,128,953 (GRCm39) D272E probably benign Het
Zfp763 A T 17: 33,238,473 (GRCm39) M224K probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78,877,568 (GRCm39) missense probably damaging 1.00
IGL01904:Triobp APN 15 78,851,564 (GRCm39) missense possibly damaging 0.80
IGL01957:Triobp APN 15 78,856,847 (GRCm39) critical splice donor site probably null
IGL02085:Triobp APN 15 78,858,497 (GRCm39) splice site probably benign
IGL02260:Triobp APN 15 78,850,562 (GRCm39) missense probably benign 0.00
IGL02498:Triobp APN 15 78,845,243 (GRCm39) missense probably benign 0.01
IGL02551:Triobp APN 15 78,857,689 (GRCm39) missense probably benign
IGL02740:Triobp APN 15 78,850,889 (GRCm39) missense probably benign 0.21
IGL02810:Triobp APN 15 78,886,403 (GRCm39) missense possibly damaging 0.95
IGL03063:Triobp APN 15 78,875,084 (GRCm39) missense probably damaging 1.00
FR4304:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
FR4340:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4342:Triobp UTSW 15 78,877,592 (GRCm39) unclassified probably benign
FR4449:Triobp UTSW 15 78,877,589 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,590 (GRCm39) unclassified probably benign
FR4548:Triobp UTSW 15 78,877,587 (GRCm39) unclassified probably benign
R0276:Triobp UTSW 15 78,857,876 (GRCm39) missense probably benign 0.09
R0309:Triobp UTSW 15 78,860,740 (GRCm39) missense probably damaging 1.00
R0433:Triobp UTSW 15 78,852,401 (GRCm39) missense possibly damaging 0.69
R0464:Triobp UTSW 15 78,851,186 (GRCm39) missense possibly damaging 0.71
R0525:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0665:Triobp UTSW 15 78,858,098 (GRCm39) missense possibly damaging 0.93
R0689:Triobp UTSW 15 78,844,188 (GRCm39) nonsense probably null
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1149:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1151:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1152:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1510:Triobp UTSW 15 78,887,967 (GRCm39) missense probably damaging 1.00
R1519:Triobp UTSW 15 78,857,938 (GRCm39) missense probably benign 0.00
R1642:Triobp UTSW 15 78,886,348 (GRCm39) missense probably damaging 1.00
R1732:Triobp UTSW 15 78,851,428 (GRCm39) missense possibly damaging 0.69
R1755:Triobp UTSW 15 78,850,679 (GRCm39) missense probably benign 0.00
R1975:Triobp UTSW 15 78,850,908 (GRCm39) missense probably benign
R2051:Triobp UTSW 15 78,888,740 (GRCm39) missense probably damaging 1.00
R2073:Triobp UTSW 15 78,858,095 (GRCm39) missense probably damaging 0.99
R2260:Triobp UTSW 15 78,875,640 (GRCm39) critical splice donor site probably null
R2351:Triobp UTSW 15 78,888,780 (GRCm39) missense probably benign 0.09
R2902:Triobp UTSW 15 78,857,618 (GRCm39) missense possibly damaging 0.90
R3801:Triobp UTSW 15 78,857,900 (GRCm39) missense probably benign 0.04
R3959:Triobp UTSW 15 78,886,589 (GRCm39) nonsense probably null
R4003:Triobp UTSW 15 78,844,177 (GRCm39) unclassified probably benign
R4084:Triobp UTSW 15 78,857,871 (GRCm39) missense probably benign 0.19
R4482:Triobp UTSW 15 78,850,763 (GRCm39) missense possibly damaging 0.87
R4592:Triobp UTSW 15 78,851,295 (GRCm39) missense probably benign
R4662:Triobp UTSW 15 78,877,469 (GRCm39) missense probably damaging 1.00
R4732:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4733:Triobp UTSW 15 78,851,313 (GRCm39) missense probably damaging 0.99
R4789:Triobp UTSW 15 78,875,228 (GRCm39) missense probably damaging 1.00
R4968:Triobp UTSW 15 78,850,816 (GRCm39) missense probably benign 0.03
R4990:Triobp UTSW 15 78,851,205 (GRCm39) missense probably benign 0.00
R5129:Triobp UTSW 15 78,845,296 (GRCm39) missense probably benign 0.15
R5181:Triobp UTSW 15 78,851,954 (GRCm39) missense probably benign 0.00
R5279:Triobp UTSW 15 78,878,591 (GRCm39) missense possibly damaging 0.66
R5584:Triobp UTSW 15 78,852,332 (GRCm39) missense possibly damaging 0.89
R5601:Triobp UTSW 15 78,857,833 (GRCm39) missense probably damaging 1.00
R5810:Triobp UTSW 15 78,852,467 (GRCm39) missense probably benign 0.07
R5969:Triobp UTSW 15 78,851,740 (GRCm39) missense probably benign 0.05
R6722:Triobp UTSW 15 78,885,765 (GRCm39) missense probably damaging 1.00
R6739:Triobp UTSW 15 78,850,566 (GRCm39) missense possibly damaging 0.77
R6810:Triobp UTSW 15 78,850,815 (GRCm39) missense possibly damaging 0.47
R7011:Triobp UTSW 15 78,862,923 (GRCm39) missense probably damaging 0.98
R7015:Triobp UTSW 15 78,878,260 (GRCm39) missense probably damaging 0.99
R7200:Triobp UTSW 15 78,851,042 (GRCm39) small deletion probably benign
R7294:Triobp UTSW 15 78,858,176 (GRCm39) missense probably damaging 0.99
R7688:Triobp UTSW 15 78,845,311 (GRCm39) splice site probably null
R7805:Triobp UTSW 15 78,858,204 (GRCm39) missense probably benign 0.37
R7972:Triobp UTSW 15 78,852,186 (GRCm39) missense probably damaging 1.00
R7977:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7987:Triobp UTSW 15 78,885,744 (GRCm39) missense probably damaging 1.00
R7999:Triobp UTSW 15 78,844,144 (GRCm39) missense probably damaging 0.99
R8344:Triobp UTSW 15 78,842,475 (GRCm39) missense possibly damaging 0.67
R8348:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8448:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8469:Triobp UTSW 15 78,851,219 (GRCm39) missense probably benign 0.00
R8491:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8492:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R8493:Triobp UTSW 15 78,878,326 (GRCm39) missense possibly damaging 0.85
R9424:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9495:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9514:Triobp UTSW 15 78,877,378 (GRCm39) missense probably damaging 1.00
R9530:Triobp UTSW 15 78,886,321 (GRCm39) missense probably damaging 1.00
R9550:Triobp UTSW 15 78,858,077 (GRCm39) missense probably damaging 1.00
R9576:Triobp UTSW 15 78,844,266 (GRCm39) missense probably damaging 1.00
R9646:Triobp UTSW 15 78,887,934 (GRCm39) missense probably damaging 1.00
RF001:Triobp UTSW 15 78,851,227 (GRCm39) small insertion probably benign
RF005:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF007:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
RF022:Triobp UTSW 15 78,858,482 (GRCm39) missense probably benign 0.05
RF028:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF032:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF035:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,239 (GRCm39) small insertion probably benign
RF039:Triobp UTSW 15 78,851,236 (GRCm39) small insertion probably benign
RF040:Triobp UTSW 15 78,851,263 (GRCm39) small insertion probably benign
RF049:Triobp UTSW 15 78,851,261 (GRCm39) small insertion probably benign
RF051:Triobp UTSW 15 78,851,234 (GRCm39) small insertion probably benign
RF058:Triobp UTSW 15 78,851,244 (GRCm39) small insertion probably benign
X0026:Triobp UTSW 15 78,844,223 (GRCm39) missense possibly damaging 0.94
Z1177:Triobp UTSW 15 78,886,381 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTACACAACCTGGGGAAGCTG -3'
(R):5'- AGTGCAGACTAGTCACACGG -3'

Sequencing Primer
(F):5'- CTGGGCTTGTGGCGTATG -3'
(R):5'- CCTTGTCTGTAAAATGGGCACAG -3'
Posted On 2020-10-20