Mutagenetix > Incidental Mutations

Incidental Mutation 'R8446:Itgb2l'

654517

Institutional Source

Beutler Lab

Gene Symbol

Itgb2l

Ensembl Gene

ENSMUSG00000000157

Gene Name

integrin beta 2-like

Synonyms

pactolus, 5033406G21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R8446 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

96422288-96443619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96432657 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 278 (Q278K)

Ref Sequence

ENSEMBL: ENSMUSP00000109403 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113795] [ENSMUST00000131567]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000161
AA Change: Q278K

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: Q278K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113773
AA Change: Q278K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: Q278K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	24	63	3.95e1	SMART
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART
EGF_like	553	585	4.64e1	SMART
Integrin_B_tail	594	669	1.22e-9	SMART
transmembrane domain	672	694	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113795

SMART Domains

Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	31	125	4.74e-5	SMART
transmembrane domain	139	161	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000131567
AA Change: Q278K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: Q278K

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PSI	24	74	2.88e-4	SMART
INB	32	419	7.05e-119	SMART
VWA	126	329	1.16e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf2	G	A	5: 24,566,643	R529*	probably null	Het
Afap1	T	A	5: 35,987,301	S122T		Het
Arnt	TG	T	3: 95,474,703		probably null	Het
Bbs1	G	A	19: 4,897,605	T307I	probably benign	Het
Cacna1c	A	T	6: 118,627,450	S1439T		Het
Camk4	T	A	18: 33,156,757	H152Q	probably damaging	Het
Capn2	A	T	1: 182,484,231	M426K	possibly damaging	Het
Chrm3	C	T	13: 9,878,302	G233S	probably damaging	Het
Clca3a1	A	T	3: 144,748,487	Y461N	probably damaging	Het
Clip1	G	C	5: 123,655,945	P12A	probably damaging	Het
Cmya5	A	G	13: 93,093,828	L1584P	possibly damaging	Het
Commd5	T	C	15: 76,900,894	S164P	probably damaging	Het
Csgalnact1	A	G	8: 68,461,091	V154A	probably damaging	Het
Ddias	C	A	7: 92,866,610	C25F	probably damaging	Het
Dnah7b	A	T	1: 46,290,715	I3240F	probably damaging	Het
Fam186a	T	G	15: 99,947,454	D303A	unknown	Het
Igkv8-27	A	G	6: 70,171,948	I74T	probably damaging	Het
Itgb7	T	C	15: 102,218,608	E464G	probably damaging	Het
Kdm2a	G	A	19: 4,356,888	Q116*	probably null	Het
Krtap5-2	TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA	TCCACAGGAACTACA	7: 142,175,108		probably benign	Het
Larp1	T	C	11: 58,051,209		probably null	Het
Lnx2	A	G	5: 147,033,359	L191S	probably benign	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Myh4	T	A	11: 67,253,521	M1239K	probably benign	Het
Nckap5l	C	A	15: 99,426,049	G858C	probably benign	Het
Nelfa	A	T	5: 33,901,638	L262Q	probably damaging	Het
Olfr137	A	G	17: 38,304,747	V238A	probably benign	Het
Olfr910	A	T	9: 38,539,668	M258L	probably benign	Het
Pdgfa	T	C	5: 138,978,640	T211A	unknown	Het
Prl3d2	A	T	13: 27,123,993	I86F	probably benign	Het
Rpf2	T	A	10: 40,239,756	T76S	probably benign	Het
Setbp1	C	T	18: 78,857,756	D899N	probably damaging	Het
Slc35c1	T	A	2: 92,454,362	E315D	probably benign	Het
Slc6a3	A	T	13: 73,571,555	M568L	possibly damaging	Het
Sorbs1	T	C	19: 40,326,158	M737V	probably benign	Het
Sox17	A	G	1: 4,492,093	Y295H	possibly damaging	Het
Tex44	A	T	1: 86,426,974	I202F	possibly damaging	Het
Tinagl1	C	T	4: 130,166,901		probably null	Het
Tlr4	T	A	4: 66,839,436	N155K	probably damaging	Het
Tmem245	T	C	4: 56,906,261	Q548R	probably benign	Het
Topbp1	T	A	9: 103,308,862	F68I	probably damaging	Het
Trim67	G	T	8: 124,793,991	A31S	probably damaging	Het
Triobp	C	T	15: 78,994,126	H1750Y	possibly damaging	Het
Ttn	A	C	2: 76,948,209	M1316R	unknown	Het
Usp40	T	C	1: 87,978,468	T682A	probably benign	Het
Wfs1	A	T	5: 36,971,609	D272E	probably benign	Het
Zfp763	A	T	17: 33,019,499	M224K	probably benign	Het

Other mutations in Itgb2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Itgb2l	APN	16	96426750	missense	probably damaging	0.98
IGL01482:Itgb2l	APN	16	96438748	missense	probably damaging	0.99
IGL01767:Itgb2l	APN	16	96430575	missense	probably benign	0.05
IGL02056:Itgb2l	APN	16	96427689	missense	probably damaging	0.97
IGL02072:Itgb2l	APN	16	96430608	missense	probably benign
IGL02858:Itgb2l	APN	16	96422650	missense	possibly damaging	0.96
R0011:Itgb2l	UTSW	16	96427661	splice site	probably benign
R0153:Itgb2l	UTSW	16	96437369	missense	possibly damaging	0.94
R0270:Itgb2l	UTSW	16	96422930	unclassified	probably benign
R0496:Itgb2l	UTSW	16	96434701	missense	possibly damaging	0.86
R0627:Itgb2l	UTSW	16	96422911	unclassified	probably benign
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1185:Itgb2l	UTSW	16	96429040	missense	possibly damaging	0.90
R1509:Itgb2l	UTSW	16	96426849	missense	probably benign	0.28
R1792:Itgb2l	UTSW	16	96425082	missense	probably damaging	1.00
R1912:Itgb2l	UTSW	16	96426935	missense	probably benign	0.17
R2210:Itgb2l	UTSW	16	96426221	missense	possibly damaging	0.82
R3160:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3162:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R3836:Itgb2l	UTSW	16	96426167	missense	probably benign
R4131:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4132:Itgb2l	UTSW	16	96437389	missense	probably damaging	0.99
R4254:Itgb2l	UTSW	16	96430577	missense	probably benign	0.00
R4854:Itgb2l	UTSW	16	96426117	nonsense	probably null
R4893:Itgb2l	UTSW	16	96427821	missense	probably benign	0.12
R4931:Itgb2l	UTSW	16	96437449	missense	probably damaging	1.00
R5039:Itgb2l	UTSW	16	96425005	missense	possibly damaging	0.69
R5055:Itgb2l	UTSW	16	96427803	missense	probably damaging	1.00
R5960:Itgb2l	UTSW	16	96426259	missense	probably benign	0.00
R6412:Itgb2l	UTSW	16	96427729	missense	probably benign	0.04
R6966:Itgb2l	UTSW	16	96430643	missense	probably benign	0.02
R7149:Itgb2l	UTSW	16	96433559	missense	probably damaging	1.00
R7278:Itgb2l	UTSW	16	96429043	missense	probably damaging	1.00
R7293:Itgb2l	UTSW	16	96426796	nonsense	probably null
R7482:Itgb2l	UTSW	16	96426833	missense	probably benign	0.01
R7570:Itgb2l	UTSW	16	96426239	missense	probably benign	0.00
R7743:Itgb2l	UTSW	16	96437408	missense	probably damaging	1.00
R7771:Itgb2l	UTSW	16	96426972	missense	probably damaging	1.00
X0018:Itgb2l	UTSW	16	96435676	missense	probably benign	0.01
Z1177:Itgb2l	UTSW	16	96437356	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATCTGGCACGCAGAAACAG -3'
(R):5'- GCACATTGCAGTTTCTGGTG -3'

Sequencing Primer
(F):5'- CAGAAACAGAACTTTGGTGATGTTG -3'
(R):5'- ACTTGAGCTGACACCAGA -3'

Posted On

2020-10-20