Incidental Mutation 'R8446:Itgb2l'
ID654517
Institutional Source Beutler Lab
Gene Symbol Itgb2l
Ensembl Gene ENSMUSG00000000157
Gene Nameintegrin beta 2-like
Synonymspactolus, 5033406G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R8446 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location96422288-96443619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 96432657 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 278 (Q278K)
Ref Sequence ENSEMBL: ENSMUSP00000109403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000161] [ENSMUST00000113773] [ENSMUST00000113795] [ENSMUST00000131567]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000161
AA Change: Q278K

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000000161
Gene: ENSMUSG00000000157
AA Change: Q278K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113773
AA Change: Q278K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109403
Gene: ENSMUSG00000000157
AA Change: Q278K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 24 63 3.95e1 SMART
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
EGF_like 553 585 4.64e1 SMART
Integrin_B_tail 594 669 1.22e-9 SMART
transmembrane domain 672 694 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113795
SMART Domains Protein: ENSMUSP00000109426
Gene: ENSMUSG00000000159

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 31 125 4.74e-5 SMART
transmembrane domain 139 161 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131567
AA Change: Q278K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114497
Gene: ENSMUSG00000000157
AA Change: Q278K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 2.88e-4 SMART
INB 32 419 7.05e-119 SMART
VWA 126 329 1.16e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display normal leukocyte development and normal neutrophil recruitment to inflamed tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clca3a1 A T 3: 144,748,487 Y461N probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Csgalnact1 A G 8: 68,461,091 V154A probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Lnx2 A G 5: 147,033,359 L191S probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr137 A G 17: 38,304,747 V238A probably benign Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Zfp763 A T 17: 33,019,499 M224K probably benign Het
Other mutations in Itgb2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Itgb2l APN 16 96426750 missense probably damaging 0.98
IGL01482:Itgb2l APN 16 96438748 missense probably damaging 0.99
IGL01767:Itgb2l APN 16 96430575 missense probably benign 0.05
IGL02056:Itgb2l APN 16 96427689 missense probably damaging 0.97
IGL02072:Itgb2l APN 16 96430608 missense probably benign
IGL02858:Itgb2l APN 16 96422650 missense possibly damaging 0.96
R0011:Itgb2l UTSW 16 96427661 splice site probably benign
R0153:Itgb2l UTSW 16 96437369 missense possibly damaging 0.94
R0270:Itgb2l UTSW 16 96422930 unclassified probably benign
R0496:Itgb2l UTSW 16 96434701 missense possibly damaging 0.86
R0627:Itgb2l UTSW 16 96422911 unclassified probably benign
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1185:Itgb2l UTSW 16 96429040 missense possibly damaging 0.90
R1509:Itgb2l UTSW 16 96426849 missense probably benign 0.28
R1792:Itgb2l UTSW 16 96425082 missense probably damaging 1.00
R1912:Itgb2l UTSW 16 96426935 missense probably benign 0.17
R2210:Itgb2l UTSW 16 96426221 missense possibly damaging 0.82
R3160:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3162:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R3836:Itgb2l UTSW 16 96426167 missense probably benign
R4131:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4132:Itgb2l UTSW 16 96437389 missense probably damaging 0.99
R4254:Itgb2l UTSW 16 96430577 missense probably benign 0.00
R4854:Itgb2l UTSW 16 96426117 nonsense probably null
R4893:Itgb2l UTSW 16 96427821 missense probably benign 0.12
R4931:Itgb2l UTSW 16 96437449 missense probably damaging 1.00
R5039:Itgb2l UTSW 16 96425005 missense possibly damaging 0.69
R5055:Itgb2l UTSW 16 96427803 missense probably damaging 1.00
R5960:Itgb2l UTSW 16 96426259 missense probably benign 0.00
R6412:Itgb2l UTSW 16 96427729 missense probably benign 0.04
R6966:Itgb2l UTSW 16 96430643 missense probably benign 0.02
R7149:Itgb2l UTSW 16 96433559 missense probably damaging 1.00
R7278:Itgb2l UTSW 16 96429043 missense probably damaging 1.00
R7293:Itgb2l UTSW 16 96426796 nonsense probably null
R7482:Itgb2l UTSW 16 96426833 missense probably benign 0.01
R7570:Itgb2l UTSW 16 96426239 missense probably benign 0.00
R7743:Itgb2l UTSW 16 96437408 missense probably damaging 1.00
R7771:Itgb2l UTSW 16 96426972 missense probably damaging 1.00
X0018:Itgb2l UTSW 16 96435676 missense probably benign 0.01
Z1177:Itgb2l UTSW 16 96437356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGGCACGCAGAAACAG -3'
(R):5'- GCACATTGCAGTTTCTGGTG -3'

Sequencing Primer
(F):5'- CAGAAACAGAACTTTGGTGATGTTG -3'
(R):5'- ACTTGAGCTGACACCAGA -3'
Posted On2020-10-20