Incidental Mutation 'R8446:Zfp763'
ID654518
Institutional Source Beutler Lab
Gene Symbol Zfp763
Ensembl Gene ENSMUSG00000067430
Gene Namezinc finger protein 763
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8446 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33016863-33033402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33019499 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 224 (M224K)
Ref Sequence ENSEMBL: ENSMUSP00000084936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087654]
Predicted Effect probably benign
Transcript: ENSMUST00000087654
AA Change: M224K

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084936
Gene: ENSMUSG00000067430
AA Change: M224K

DomainStartEndE-ValueType
KRAB 10 60 7.47e-14 SMART
ZnF_C2H2 223 245 2.53e-2 SMART
ZnF_C2H2 251 273 4.54e-4 SMART
ZnF_C2H2 279 301 1.69e-3 SMART
ZnF_C2H2 307 329 5.72e-1 SMART
ZnF_C2H2 335 357 1.64e-1 SMART
ZnF_C2H2 363 385 1.56e-2 SMART
ZnF_C2H2 391 413 1.82e-3 SMART
ZnF_C2H2 419 441 1.64e-1 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
ZnF_C2H2 475 497 2.02e-1 SMART
ZnF_C2H2 503 525 7.15e-2 SMART
ZnF_C2H2 531 553 1.79e-2 SMART
ZnF_C2H2 559 581 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clca3a1 A T 3: 144,748,487 Y461N probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Csgalnact1 A G 8: 68,461,091 V154A probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb2l G T 16: 96,432,657 Q278K probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Lnx2 A G 5: 147,033,359 L191S probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr137 A G 17: 38,304,747 V238A probably benign Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Other mutations in Zfp763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Zfp763 APN 17 33019934 missense probably benign 0.41
IGL03291:Zfp763 APN 17 33019886 missense probably damaging 0.96
R0346:Zfp763 UTSW 17 33019747 missense probably benign 0.26
R0675:Zfp763 UTSW 17 33019800 missense possibly damaging 0.92
R0683:Zfp763 UTSW 17 33018918 missense probably damaging 1.00
R1494:Zfp763 UTSW 17 33021503 missense probably damaging 0.99
R1521:Zfp763 UTSW 17 33033302 start codon destroyed probably benign 0.03
R1607:Zfp763 UTSW 17 33019907 missense probably benign 0.08
R1627:Zfp763 UTSW 17 33021784 missense probably damaging 1.00
R1714:Zfp763 UTSW 17 33019617 missense probably damaging 0.99
R1993:Zfp763 UTSW 17 33018439 missense probably damaging 1.00
R2109:Zfp763 UTSW 17 33019778 missense probably benign
R4420:Zfp763 UTSW 17 33018481 missense probably benign 0.43
R4612:Zfp763 UTSW 17 33018948 missense probably benign 0.05
R5114:Zfp763 UTSW 17 33018975 missense probably damaging 0.99
R5426:Zfp763 UTSW 17 33019595 missense probably benign
R5503:Zfp763 UTSW 17 33019533 missense possibly damaging 0.95
R5534:Zfp763 UTSW 17 33021794 missense probably damaging 0.97
R6133:Zfp763 UTSW 17 33018701 missense possibly damaging 0.75
R7141:Zfp763 UTSW 17 33018795 missense probably damaging 0.97
R7365:Zfp763 UTSW 17 33033378 start gained probably benign
R7430:Zfp763 UTSW 17 33019532 missense possibly damaging 0.68
R7552:Zfp763 UTSW 17 33018651 missense probably benign
R8277:Zfp763 UTSW 17 33033320 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGAACGAACAAAGGCTTTGC -3'
(R):5'- CCTCTCACATACTAGAAGGTCCCAG -3'

Sequencing Primer
(F):5'- TTTGCCACACTGCTTACACACATAAG -3'
(R):5'- AAGGTCCCAGAGAGATAGTTTATC -3'
Posted On2020-10-20