Incidental Mutation 'R8446:Olfr137'
ID654519
Institutional Source Beutler Lab
Gene Symbol Olfr137
Ensembl Gene ENSMUSG00000054940
Gene Nameolfactory receptor 137
SynonymsMOR256-18, GA_x6K02T2PSCP-2749525-2748587
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R8446 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38303527-38307570 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38304747 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 238 (V238A)
Ref Sequence ENSEMBL: ENSMUSP00000150173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057394] [ENSMUST00000213505]
Predicted Effect probably benign
Transcript: ENSMUST00000057394
AA Change: V238A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051537
Gene: ENSMUSG00000054940
AA Change: V238A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4e-49 PFAM
Pfam:7tm_1 42 291 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213505
AA Change: V238A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 G A 5: 24,566,643 R529* probably null Het
Afap1 T A 5: 35,987,301 S122T Het
Arnt TG T 3: 95,474,703 probably null Het
Bbs1 G A 19: 4,897,605 T307I probably benign Het
Cacna1c A T 6: 118,627,450 S1439T Het
Camk4 T A 18: 33,156,757 H152Q probably damaging Het
Capn2 A T 1: 182,484,231 M426K possibly damaging Het
Chrm3 C T 13: 9,878,302 G233S probably damaging Het
Clca3a1 A T 3: 144,748,487 Y461N probably damaging Het
Clip1 G C 5: 123,655,945 P12A probably damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Commd5 T C 15: 76,900,894 S164P probably damaging Het
Csgalnact1 A G 8: 68,461,091 V154A probably damaging Het
Ddias C A 7: 92,866,610 C25F probably damaging Het
Dnah7b A T 1: 46,290,715 I3240F probably damaging Het
Fam186a T G 15: 99,947,454 D303A unknown Het
Igkv8-27 A G 6: 70,171,948 I74T probably damaging Het
Itgb2l G T 16: 96,432,657 Q278K probably damaging Het
Itgb7 T C 15: 102,218,608 E464G probably damaging Het
Kdm2a G A 19: 4,356,888 Q116* probably null Het
Krtap5-2 TCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA TCCACAGGAACTACA 7: 142,175,108 probably benign Het
Larp1 T C 11: 58,051,209 probably null Het
Lnx2 A G 5: 147,033,359 L191S probably benign Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Myh4 T A 11: 67,253,521 M1239K probably benign Het
Nckap5l C A 15: 99,426,049 G858C probably benign Het
Nelfa A T 5: 33,901,638 L262Q probably damaging Het
Olfr910 A T 9: 38,539,668 M258L probably benign Het
Pdgfa T C 5: 138,978,640 T211A unknown Het
Prl3d2 A T 13: 27,123,993 I86F probably benign Het
Rpf2 T A 10: 40,239,756 T76S probably benign Het
Setbp1 C T 18: 78,857,756 D899N probably damaging Het
Slc35c1 T A 2: 92,454,362 E315D probably benign Het
Slc6a3 A T 13: 73,571,555 M568L possibly damaging Het
Sorbs1 T C 19: 40,326,158 M737V probably benign Het
Sox17 A G 1: 4,492,093 Y295H possibly damaging Het
Tex44 A T 1: 86,426,974 I202F possibly damaging Het
Tinagl1 C T 4: 130,166,901 probably null Het
Tlr4 T A 4: 66,839,436 N155K probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Topbp1 T A 9: 103,308,862 F68I probably damaging Het
Trim67 G T 8: 124,793,991 A31S probably damaging Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttn A C 2: 76,948,209 M1316R unknown Het
Usp40 T C 1: 87,978,468 T682A probably benign Het
Wfs1 A T 5: 36,971,609 D272E probably benign Het
Zfp763 A T 17: 33,019,499 M224K probably benign Het
Other mutations in Olfr137
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Olfr137 APN 17 38304648 missense probably benign 0.03
IGL03169:Olfr137 APN 17 38305101 missense probably damaging 1.00
IGL03392:Olfr137 APN 17 38304895 missense probably benign 0.02
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0055:Olfr137 UTSW 17 38304811 missense possibly damaging 0.84
R0496:Olfr137 UTSW 17 38304658 missense probably damaging 0.99
R0761:Olfr137 UTSW 17 38305391 missense probably benign 0.00
R1126:Olfr137 UTSW 17 38304688 missense probably damaging 0.97
R1835:Olfr137 UTSW 17 38305312 missense probably benign 0.02
R3727:Olfr137 UTSW 17 38305419 missense possibly damaging 0.64
R5556:Olfr137 UTSW 17 38305073 missense possibly damaging 0.71
R5979:Olfr137 UTSW 17 38305192 missense probably benign
R6430:Olfr137 UTSW 17 38305358 missense probably benign 0.04
R6433:Olfr137 UTSW 17 38305413 missense probably damaging 1.00
R7400:Olfr137 UTSW 17 38305331 missense possibly damaging 0.91
R8053:Olfr137 UTSW 17 38305210 missense probably benign
R8199:Olfr137 UTSW 17 38304553 missense probably benign 0.31
R8865:Olfr137 UTSW 17 38304981 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGAGGCTTATCTCATTTCTCC -3'
(R):5'- CTTCTGTGAAGTGCCTGCAC -3'

Sequencing Primer
(F):5'- ATACCTACTCAGCCTCCTTATTGC -3'
(R):5'- CACTGTTGCAGTTGTCCTGTG -3'
Posted On2020-10-20