Incidental Mutation 'R8447:Cfap46'
ID 654548
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 139680986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 65 (R65S)
Ref Sequence ENSEMBL: ENSMUSP00000115437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
AlphaFold E9Q2C0
Predicted Effect
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: R124S

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130453
AA Change: R65S

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571
AA Change: R65S

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000140820
AA Change: R124S

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: R124S

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clec16a C A 16: 10,741,623 T920K probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Ripor2 T A 13: 24,723,788 L1014Q probably damaging Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Spata20 C A 11: 94,482,254 L515F probably damaging Het
Tcf20 G A 15: 82,853,236 S1338F possibly damaging Het
Tm9sf2 C A 14: 122,139,768 P236Q probably damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCGTAATCAGGGACTCATCAGGG -3'
(R):5'- CATTGCTCGTGTGGGAAAGG -3'

Sequencing Primer
(F):5'- CAGGGACTCATCAGGGCTGTTAG -3'
(R):5'- CGTGTGGGAAAGGGCTGTC -3'
Posted On 2020-10-20