Incidental Mutation 'R8447:Kndc1'
ID 654549
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 067902-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139481121 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: V69A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: V69A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121839
AA Change: V69A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129
AA Change: V69A

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,957,278 (GRCm39) T136P probably damaging Het
Abcc3 A T 11: 94,254,886 (GRCm39) L639Q possibly damaging Het
Adam10 T A 9: 70,655,400 (GRCm39) N289K probably damaging Het
Akap12 A G 10: 4,306,289 (GRCm39) E1138G probably benign Het
Akr1e1 C A 13: 4,648,793 (GRCm39) L167F probably damaging Het
Cars1 T C 7: 143,123,766 (GRCm39) K506E possibly damaging Het
Castor1 T C 11: 4,170,165 (GRCm39) V81A probably damaging Het
Cfap46 C A 7: 139,260,902 (GRCm39) R65S possibly damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Clec16a C A 16: 10,559,487 (GRCm39) T920K probably benign Het
Coro2b C T 9: 62,333,842 (GRCm39) E351K probably damaging Het
Diablo T C 5: 123,655,829 (GRCm39) E163G probably damaging Het
Dnah6 A G 6: 73,115,757 (GRCm39) L1547P probably damaging Het
Dynll2 G T 11: 87,874,719 (GRCm39) D37E probably benign Het
Eml4 A T 17: 83,755,656 (GRCm39) Q408L probably damaging Het
F2rl3 T C 8: 73,489,963 (GRCm39) *397R probably null Het
Fance T A 17: 28,545,155 (GRCm39) L127Q unknown Het
Fat4 T C 3: 39,033,824 (GRCm39) V2492A possibly damaging Het
Ggta1 C T 2: 35,292,573 (GRCm39) D245N probably damaging Het
Gli1 T C 10: 127,166,106 (GRCm39) N1049S probably benign Het
Grin2c A G 11: 115,148,215 (GRCm39) V354A probably benign Het
Kank4 T A 4: 98,666,729 (GRCm39) I573F probably damaging Het
Kdm3a A G 6: 71,588,881 (GRCm39) V376A probably benign Het
Lcmt1 T A 7: 123,020,825 (GRCm39) L250Q probably damaging Het
Ldhb A T 6: 142,444,356 (GRCm39) V99D probably damaging Het
Lepr T C 4: 101,671,688 (GRCm39) V904A probably benign Het
Lipe G T 7: 25,080,017 (GRCm39) N710K probably damaging Het
Med1 C A 11: 98,060,240 (GRCm39) D230Y probably damaging Het
Mpv17l T A 16: 13,758,864 (GRCm39) I96K probably benign Het
Obox1 A T 7: 15,289,541 (GRCm39) Q110L probably damaging Het
Or11h6 T C 14: 50,880,008 (GRCm39) V84A probably benign Het
Or4f4b T A 2: 111,314,101 (GRCm39) Y137N probably damaging Het
Or4k37 T A 2: 111,159,307 (GRCm39) I181N possibly damaging Het
Or5t16 T A 2: 86,818,885 (GRCm39) I212F probably benign Het
Or6c76 T G 10: 129,612,371 (GRCm39) M211R possibly damaging Het
Or9s14 C A 1: 92,535,494 (GRCm39) probably benign Het
Pah T C 10: 87,417,827 (GRCm39) probably null Het
Pate1 A T 9: 35,597,631 (GRCm39) N40K probably benign Het
Pclo C A 5: 14,731,423 (GRCm39) D182E Het
Prl7a2 A T 13: 27,849,941 (GRCm39) S44T possibly damaging Het
Pwp2 T A 10: 78,007,873 (GRCm39) D894V probably benign Het
Ripor2 T A 13: 24,907,771 (GRCm39) L1014Q probably damaging Het
Rpe G A 1: 66,740,188 (GRCm39) probably null Het
Sh2d3c A G 2: 32,642,671 (GRCm39) T706A probably damaging Het
Slc34a1 T C 13: 24,006,309 (GRCm39) F445S possibly damaging Het
Spata20 C A 11: 94,373,080 (GRCm39) L515F probably damaging Het
Tcf20 G A 15: 82,737,437 (GRCm39) S1338F possibly damaging Het
Tm9sf2 C A 14: 122,377,180 (GRCm39) P236Q probably damaging Het
Tmem135 T C 7: 88,803,240 (GRCm39) Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 (GRCm39) Q548R probably benign Het
Tmem94 G T 11: 115,688,023 (GRCm39) C1190F possibly damaging Het
Tmem94 G A 11: 115,688,696 (GRCm39) R1301H probably benign Het
Zp3 G A 5: 136,013,244 (GRCm39) G192E probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8134:Kndc1 UTSW 7 139,481,285 (GRCm39) splice site probably null
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACTGGTGCAGTATTCTCCG -3'
(R):5'- AAAGAAACTGGGGCCTCGTG -3'

Sequencing Primer
(F):5'- GCAGTATTCTCCGGATGGACTAC -3'
(R):5'- AACTGCTCCGTGCTTCCAG -3'
Posted On 2020-10-20