Incidental Mutation 'R8447:Spata20'
ID 654563
Institutional Source Beutler Lab
Gene Symbol Spata20
Ensembl Gene ENSMUSG00000020867
Gene Name spermatogenesis associated 20
Synonyms Tisp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock # R8447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 94478904-94486179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 94482254 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 515 (L515F)
Ref Sequence ENSEMBL: ENSMUSP00000042572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041705]
AlphaFold Q80YT5
Predicted Effect probably damaging
Transcript: ENSMUST00000041705
AA Change: L515F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042572
Gene: ENSMUSG00000020867
AA Change: L515F

DomainStartEndE-ValueType
Pfam:Thioredox_DsbH 66 228 2.9e-75 PFAM
Pfam:Thioredoxin_7 86 176 1.5e-13 PFAM
SCOP:d1fp3a_ 464 686 8e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap46 C A 7: 139,680,986 R65S possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clec16a C A 16: 10,741,623 T920K probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Ripor2 T A 13: 24,723,788 L1014Q probably damaging Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Tcf20 G A 15: 82,853,236 S1338F possibly damaging Het
Tm9sf2 C A 14: 122,139,768 P236Q probably damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Spata20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Spata20 APN 11 94479117 missense probably damaging 1.00
IGL01123:Spata20 APN 11 94483395 missense probably benign
IGL02008:Spata20 APN 11 94483463 missense probably damaging 1.00
PIT4458001:Spata20 UTSW 11 94484608 missense probably damaging 1.00
R0136:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R0243:Spata20 UTSW 11 94481646 missense probably benign
R0557:Spata20 UTSW 11 94485222 missense probably benign 0.00
R0657:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R1712:Spata20 UTSW 11 94480514 missense probably benign
R2166:Spata20 UTSW 11 94479104 missense probably benign 0.25
R4298:Spata20 UTSW 11 94483088 missense probably damaging 0.99
R4740:Spata20 UTSW 11 94484578 missense possibly damaging 0.94
R4791:Spata20 UTSW 11 94484586 missense probably damaging 0.99
R4980:Spata20 UTSW 11 94484609 missense probably damaging 1.00
R5894:Spata20 UTSW 11 94483618 missense probably damaging 0.98
R6373:Spata20 UTSW 11 94483400 missense probably benign
R7400:Spata20 UTSW 11 94483400 missense probably benign
R7439:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7441:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7562:Spata20 UTSW 11 94482553 missense probably benign 0.31
R7974:Spata20 UTSW 11 94484140 missense possibly damaging 0.66
R8036:Spata20 UTSW 11 94479137 missense probably benign 0.17
R8060:Spata20 UTSW 11 94482239 missense probably benign
R8335:Spata20 UTSW 11 94482543 missense probably benign 0.05
R8676:Spata20 UTSW 11 94481781 missense probably damaging 1.00
Z1176:Spata20 UTSW 11 94480535 missense probably benign 0.45
Z1177:Spata20 UTSW 11 94483139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATGGCCTCATGGTCTGC -3'
(R):5'- AGCTCTATTTGCCAAGCCCC -3'

Sequencing Primer
(F):5'- TGGTCTGCCCAGCCTCC -3'
(R):5'- CTTCATAGGCCTTTTGAAATTTTGAC -3'
Posted On 2020-10-20