Incidental Mutation 'R8447:Ripor2'
ID654570
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8447 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24723788 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1014 (L1014Q)
Ref Sequence ENSEMBL: ENSMUSP00000106013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110383] [ENSMUST00000110384]
Predicted Effect probably damaging
Transcript: ENSMUST00000110383
AA Change: L989Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: L989Q

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110384
AA Change: L1014Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: L1014Q

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap46 C A 7: 139,680,986 R65S possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clec16a C A 16: 10,741,623 T920K probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Spata20 C A 11: 94,482,254 L515F probably damaging Het
Tcf20 G A 15: 82,853,236 S1338F possibly damaging Het
Tm9sf2 C A 14: 122,139,768 P236Q probably damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6382:Ripor2 UTSW 13 24677845 missense possibly damaging 0.89
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
R8081:Ripor2 UTSW 13 24713700 missense probably benign 0.01
R8157:Ripor2 UTSW 13 24695617 missense probably benign 0.05
R8364:Ripor2 UTSW 13 24710193 missense possibly damaging 0.95
R8465:Ripor2 UTSW 13 24665468 intron probably benign
R8751:Ripor2 UTSW 13 24701067 missense possibly damaging 0.69
R8818:Ripor2 UTSW 13 24717668 missense not run
Predicted Primers PCR Primer
(F):5'- GGGAGAAGATATTCCGTATCCC -3'
(R):5'- GACGAGAGACACTGCTACAC -3'

Sequencing Primer
(F):5'- GGAGAAGATATTCCGTATCCCCCTAC -3'
(R):5'- CACTGCTACACTACTAGAGAATGTG -3'
Posted On2020-10-20