Incidental Mutation 'R8447:Tm9sf2'
ID 654573
Institutional Source Beutler Lab
Gene Symbol Tm9sf2
Ensembl Gene ENSMUSG00000025544
Gene Name transmembrane 9 superfamily member 2
Synonyms D14Ertd64e, P76, 1500001N15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock # R8447 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 122107038-122159604 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 122139768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 236 (P236Q)
Ref Sequence ENSEMBL: ENSMUSP00000026624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026624] [ENSMUST00000170007] [ENSMUST00000171318]
AlphaFold P58021
Predicted Effect probably damaging
Transcript: ENSMUST00000026624
AA Change: P236Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026624
Gene: ENSMUSG00000025544
AA Change: P236Q

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 74 619 4.5e-209 PFAM
transmembrane domain 630 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170007
SMART Domains Protein: ENSMUSP00000128894
Gene: ENSMUSG00000025544

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171318
SMART Domains Protein: ENSMUSP00000131227
Gene: ENSMUSG00000025544

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:EMP70 73 112 5.9e-9 PFAM
Pfam:EMP70 109 455 1e-172 PFAM
transmembrane domain 465 487 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 9 superfamily. The encoded 76 kDa protein localizes to early endosomes in human cells. The encoded protein possesses a conserved and highly hydrophobic C-terminal domain which contains nine transmembrane domains. The protein may play a role in small molecule transport or act as an ion channel. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap46 C A 7: 139,680,986 R65S possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clec16a C A 16: 10,741,623 T920K probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Ripor2 T A 13: 24,723,788 L1014Q probably damaging Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Spata20 C A 11: 94,482,254 L515F probably damaging Het
Tcf20 G A 15: 82,853,236 S1338F possibly damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Tm9sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Tm9sf2 APN 14 122143460 missense probably damaging 1.00
IGL01995:Tm9sf2 APN 14 122143471 missense probably benign 0.25
IGL02173:Tm9sf2 APN 14 122143423 missense probably benign 0.13
IGL02249:Tm9sf2 APN 14 122123750 missense probably damaging 1.00
IGL02328:Tm9sf2 APN 14 122143430 missense possibly damaging 0.79
IGL03231:Tm9sf2 APN 14 122141252 missense possibly damaging 0.95
R0367:Tm9sf2 UTSW 14 122155368 missense probably benign 0.06
R1959:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
R2251:Tm9sf2 UTSW 14 122139731 missense probably benign
R2504:Tm9sf2 UTSW 14 122158684 missense probably benign 0.01
R4791:Tm9sf2 UTSW 14 122139650 missense probably benign 0.00
R4795:Tm9sf2 UTSW 14 122149840 splice site probably null
R4851:Tm9sf2 UTSW 14 122141204 missense probably benign 0.00
R5063:Tm9sf2 UTSW 14 122145146 missense probably damaging 1.00
R5117:Tm9sf2 UTSW 14 122143501 missense probably benign 0.30
R5443:Tm9sf2 UTSW 14 122126195 missense probably damaging 0.97
R5677:Tm9sf2 UTSW 14 122151962 critical splice acceptor site probably null
R5966:Tm9sf2 UTSW 14 122137509 intron probably benign
R6465:Tm9sf2 UTSW 14 122141207 missense probably benign 0.16
R6873:Tm9sf2 UTSW 14 122145113 missense probably damaging 1.00
R7403:Tm9sf2 UTSW 14 122141228 missense probably benign 0.33
R7531:Tm9sf2 UTSW 14 122142412 missense possibly damaging 0.49
R8176:Tm9sf2 UTSW 14 122137501 missense probably benign 0.01
R8773:Tm9sf2 UTSW 14 122143471 missense probably benign 0.21
R9039:Tm9sf2 UTSW 14 122126164 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAACACTGTGCTTGGTTGTCC -3'
(R):5'- ACTTCCCCTTTGGACCTAGG -3'

Sequencing Primer
(F):5'- CACTGTGCTTGGTTGTCCTGTAG -3'
(R):5'- ACATAATCTCACTCTTTGGGGCAGG -3'
Posted On 2020-10-20