Incidental Mutation 'R8447:Tcf20'
ID654574
Institutional Source Beutler Lab
Gene Symbol Tcf20
Ensembl Gene ENSMUSG00000041852
Gene Nametranscription factor 20
Synonymsstromelysin 1 PDGF responsive element binding protein, 2810438H08Rik, SPBP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R8447 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82808436-82987872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82853236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1338 (S1338F)
Ref Sequence ENSEMBL: ENSMUSP00000105136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048966] [ENSMUST00000109510] [ENSMUST00000229439] [ENSMUST00000229547] [ENSMUST00000230403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048966
AA Change: S1338F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048486
Gene: ENSMUSG00000041852
AA Change: S1338F

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109510
AA Change: S1338F

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105136
Gene: ENSMUSG00000041852
AA Change: S1338F

DomainStartEndE-ValueType
low complexity region 42 74 N/A INTRINSIC
coiled coil region 163 203 N/A INTRINSIC
low complexity region 248 277 N/A INTRINSIC
low complexity region 322 354 N/A INTRINSIC
low complexity region 396 416 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
low complexity region 511 523 N/A INTRINSIC
low complexity region 684 715 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
low complexity region 1532 1544 N/A INTRINSIC
low complexity region 1577 1593 N/A INTRINSIC
low complexity region 1602 1617 N/A INTRINSIC
low complexity region 1793 1804 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
PHD 1913 1960 6.7e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229439
Predicted Effect probably benign
Transcript: ENSMUST00000229547
Predicted Effect probably benign
Transcript: ENSMUST00000230403
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that recognizes the platelet-derived growth factor-responsive element in the matrix metalloproteinase 3 promoter. The encoded protein is thought to be a transcriptional coactivator, enhancing the activity of transcription factors such as JUN and SP1. Mutations in this gene are associated with autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A C 5: 8,907,278 T136P probably damaging Het
Abcc3 A T 11: 94,364,060 L639Q possibly damaging Het
Adam10 T A 9: 70,748,118 N289K probably damaging Het
Akap12 A G 10: 4,356,289 E1138G probably benign Het
Akr1e1 C A 13: 4,598,794 L167F probably damaging Het
Cars T C 7: 143,570,029 K506E possibly damaging Het
Cfap46 C A 7: 139,680,986 R65S possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clec16a C A 16: 10,741,623 T920K probably benign Het
Coro2b C T 9: 62,426,560 E351K probably damaging Het
Diablo T C 5: 123,517,766 E163G probably damaging Het
Dnah6 A G 6: 73,138,774 L1547P probably damaging Het
Dynll2 G T 11: 87,983,893 D37E probably benign Het
Eml4 A T 17: 83,448,227 Q408L probably damaging Het
F2rl3 T C 8: 72,763,335 *397R probably null Het
Fance T A 17: 28,326,181 L127Q unknown Het
Fat4 T C 3: 38,979,675 V2492A possibly damaging Het
Gatsl3 T C 11: 4,220,165 V81A probably damaging Het
Ggta1 C T 2: 35,402,561 D245N probably damaging Het
Gli1 T C 10: 127,330,237 N1049S probably benign Het
Grin2c A G 11: 115,257,389 V354A probably benign Het
Kank4 T A 4: 98,778,492 I573F probably damaging Het
Kdm3a A G 6: 71,611,897 V376A probably benign Het
Kndc1 T C 7: 139,901,205 V69A probably damaging Het
Lcmt1 T A 7: 123,421,602 L250Q probably damaging Het
Ldhb A T 6: 142,498,630 V99D probably damaging Het
Lepr T C 4: 101,814,491 V904A probably benign Het
Lipe G T 7: 25,380,592 N710K probably damaging Het
Med1 C A 11: 98,169,414 D230Y probably damaging Het
Mpv17l T A 16: 13,941,000 I96K probably benign Het
Obox1 A T 7: 15,555,616 Q110L probably damaging Het
Olfr1101 T A 2: 86,988,541 I212F probably benign Het
Olfr1281 T A 2: 111,328,962 I181N possibly damaging Het
Olfr1289 T A 2: 111,483,756 Y137N probably damaging Het
Olfr1410 C A 1: 92,607,772 probably benign Het
Olfr745 T C 14: 50,642,551 V84A probably benign Het
Olfr809 T G 10: 129,776,502 M211R possibly damaging Het
Pah T C 10: 87,581,965 probably null Het
Pate1 A T 9: 35,686,335 N40K probably benign Het
Pclo C A 5: 14,681,409 D182E Het
Prl7a2 A T 13: 27,665,958 S44T possibly damaging Het
Pwp2 T A 10: 78,172,039 D894V probably benign Het
Ripor2 T A 13: 24,723,788 L1014Q probably damaging Het
Rpe G A 1: 66,701,029 probably null Het
Sh2d3c A G 2: 32,752,659 T706A probably damaging Het
Slc17a2 T C 13: 23,822,326 F445S possibly damaging Het
Spata20 C A 11: 94,482,254 L515F probably damaging Het
Tm9sf2 C A 14: 122,139,768 P236Q probably damaging Het
Tmem135 T C 7: 89,154,032 Y311C probably damaging Het
Tmem245 T C 4: 56,906,261 Q548R probably benign Het
Tmem94 G A 11: 115,797,870 R1301H probably benign Het
Tmem94 G T 11: 115,797,197 C1190F possibly damaging Het
Zp3 G A 5: 135,984,390 G192E probably damaging Het
Other mutations in Tcf20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tcf20 APN 15 82854895 missense probably damaging 1.00
IGL00229:Tcf20 APN 15 82857142 missense possibly damaging 0.50
IGL00539:Tcf20 APN 15 82852756 missense probably benign 0.41
IGL00576:Tcf20 APN 15 82856075 missense probably damaging 1.00
IGL01135:Tcf20 APN 15 82853900 missense probably benign
IGL01670:Tcf20 APN 15 82855363 missense possibly damaging 0.77
IGL01684:Tcf20 APN 15 82857160 missense probably damaging 1.00
IGL01767:Tcf20 APN 15 82856008 missense probably damaging 1.00
IGL01825:Tcf20 APN 15 82852966 missense probably benign
IGL01834:Tcf20 APN 15 82855697 missense probably damaging 0.99
IGL01836:Tcf20 APN 15 82855155 missense probably damaging 0.99
IGL02415:Tcf20 APN 15 82853459 missense probably benign 0.28
IGL02731:Tcf20 APN 15 82853237 missense probably benign 0.00
IGL02739:Tcf20 APN 15 82856080 missense probably damaging 1.00
IGL03058:Tcf20 APN 15 82852004 missense probably damaging 0.96
PIT4131001:Tcf20 UTSW 15 82851584 missense probably damaging 0.96
R0184:Tcf20 UTSW 15 82852300 missense probably damaging 0.99
R0207:Tcf20 UTSW 15 82855085 missense probably benign
R0732:Tcf20 UTSW 15 82852303 missense probably benign 0.07
R1502:Tcf20 UTSW 15 82855576 missense probably damaging 1.00
R1575:Tcf20 UTSW 15 82855492 missense probably benign 0.19
R1719:Tcf20 UTSW 15 82852777 missense probably benign 0.03
R1997:Tcf20 UTSW 15 82857230 nonsense probably null
R2152:Tcf20 UTSW 15 82855602 missense probably damaging 1.00
R2173:Tcf20 UTSW 15 82854692 missense possibly damaging 0.62
R2288:Tcf20 UTSW 15 82851685 missense probably benign
R4049:Tcf20 UTSW 15 82853429 missense probably damaging 1.00
R4496:Tcf20 UTSW 15 82854984 missense probably damaging 1.00
R4704:Tcf20 UTSW 15 82851727 missense possibly damaging 0.49
R4892:Tcf20 UTSW 15 82854199 missense possibly damaging 0.80
R5164:Tcf20 UTSW 15 82856603 missense probably damaging 1.00
R5207:Tcf20 UTSW 15 82856185 missense probably damaging 0.98
R5219:Tcf20 UTSW 15 82856381 missense probably damaging 1.00
R5228:Tcf20 UTSW 15 82855955 missense probably benign 0.01
R5288:Tcf20 UTSW 15 82855709 missense possibly damaging 0.50
R5374:Tcf20 UTSW 15 82851957 missense probably damaging 0.99
R5384:Tcf20 UTSW 15 82856199 missense probably damaging 0.99
R5677:Tcf20 UTSW 15 82853242 missense probably benign 0.05
R5897:Tcf20 UTSW 15 82851783 nonsense probably null
R6089:Tcf20 UTSW 15 82853208 missense probably benign 0.06
R6196:Tcf20 UTSW 15 82851986 missense possibly damaging 0.89
R6229:Tcf20 UTSW 15 82854880 missense probably damaging 1.00
R6448:Tcf20 UTSW 15 82852660 missense probably benign
R6688:Tcf20 UTSW 15 82854535 missense possibly damaging 0.68
R7009:Tcf20 UTSW 15 82854682 missense probably benign 0.07
R7051:Tcf20 UTSW 15 82856078 missense probably damaging 1.00
R7215:Tcf20 UTSW 15 82853489 missense probably benign
R7486:Tcf20 UTSW 15 82853734 missense possibly damaging 0.78
R7583:Tcf20 UTSW 15 82855276 missense possibly damaging 0.82
R7678:Tcf20 UTSW 15 82851565 missense possibly damaging 0.92
R8090:Tcf20 UTSW 15 82856006 missense probably damaging 1.00
R8156:Tcf20 UTSW 15 82852937 missense probably benign 0.00
R8191:Tcf20 UTSW 15 82853405 nonsense probably null
R8259:Tcf20 UTSW 15 82852273 missense probably damaging 1.00
R8339:Tcf20 UTSW 15 82852676 missense probably benign 0.04
RF019:Tcf20 UTSW 15 82851593 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCAGTGTGACTGTGTCTCCC -3'
(R):5'- TTTAATCATGCGAAGGCGGG -3'

Sequencing Primer
(F):5'- CCAGCCTCAGCACTGTTTG -3'
(R):5'- CGAAGGCGGGTTCGTTC -3'
Posted On2020-10-20