Incidental Mutation 'R8448:Pde4a'
ID654611
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R8448 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21206238 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 599 (F599L)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
AA Change: F365L

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177
AA Change: F365L

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039413
AA Change: F599L

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: F599L

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115458
AA Change: F542L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: F542L

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cntrob A G 11: 69,299,853 F46L unknown Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Fggy A G 4: 95,844,190 T473A probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Krt6b A G 15: 101,678,020 Y345H probably damaging Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Med17 C T 9: 15,262,439 probably null Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Notch4 A T 17: 34,586,789 probably null Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Ralgps2 A T 1: 156,824,174 probably null Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tlr6 T C 5: 64,953,842 Y574C probably damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
R8167:Pde4a UTSW 9 21206173 missense possibly damaging 0.95
R8297:Pde4a UTSW 9 21166108 missense possibly damaging 0.94
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCAATTCACCTGCCCAG -3'
(R):5'- GAGTCAGACACTGATTTTGTCGT -3'

Sequencing Primer
(F):5'- CAGCTGGGACTCTATTTGGAAACC -3'
(R):5'- CAGACACTGATTTTGTCGTCCTGG -3'
Posted On2020-10-20