Incidental Mutation 'R8448:Cntrob'
ID 654617
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Lip8, 9830165K03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.198) question?
Stock # R8448 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 69299487-69323775 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69299853 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 46 (F46L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176] [ENSMUST00000130780]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000092973
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect probably benign
Transcript: ENSMUST00000130780
SMART Domains Protein: ENSMUSP00000134842
Gene: ENSMUSG00000032782

DomainStartEndE-ValueType
low complexity region 50 64 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176938
AA Change: F46L
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,285,144 L18Q probably damaging Het
4933430I17Rik T C 4: 62,542,785 probably null Het
Adamts6 T A 13: 104,479,519 C1030S probably damaging Het
Adamtsl3 C A 7: 82,603,799 T1527K possibly damaging Het
Akap9 G A 5: 3,948,897 probably null Het
Ankle2 C A 5: 110,242,043 P457T possibly damaging Het
Ankrd7 A G 6: 18,868,008 N91S probably damaging Het
Ascc3 C A 10: 50,618,077 Q203K probably benign Het
Baz2b A T 2: 59,911,793 D61E Het
Bmpr1a T A 14: 34,414,802 K477N probably benign Het
Cacna1d T C 14: 30,102,407 I1040V probably damaging Het
Cdkn2a C A 4: 89,282,054 V20L possibly damaging Het
Chd5 A G 4: 152,360,716 S385G probably damaging Het
Cth T C 3: 157,925,020 D4G probably benign Het
Cyld C T 8: 88,729,569 H416Y probably damaging Het
Dennd6a C A 14: 26,606,943 H264Q possibly damaging Het
Dnah1 T C 14: 31,293,725 Y1672C probably damaging Het
Dnah8 A G 17: 30,673,840 I800V probably benign Het
Esrp2 A G 8: 106,132,221 Y595H probably damaging Het
F12 T A 13: 55,418,488 Y497F probably benign Het
Fggy A G 4: 95,844,190 T473A probably benign Het
Gatsl2 T C 5: 134,138,116 F304L possibly damaging Het
Gm884 T A 11: 103,620,900 T81S unknown Het
Gstt2 C A 10: 75,832,692 R107L probably damaging Het
Hectd4 A T 5: 121,220,256 probably benign Het
Helb A G 10: 120,102,886 F561S probably damaging Het
Ints2 T C 11: 86,255,423 T120A probably benign Het
Kdm5d G A Y: 914,056 R331H probably benign Het
Krt6b A G 15: 101,678,020 Y345H probably damaging Het
Limch1 A G 5: 67,002,482 K418E probably damaging Het
Med17 C T 9: 15,262,439 probably null Het
Met A T 6: 17,571,800 I1373F probably benign Het
Naip6 T A 13: 100,300,386 Q543L possibly damaging Het
Nat9 T C 11: 115,185,076 T40A probably damaging Het
Notch4 A T 17: 34,586,789 probably null Het
Ogdh A G 11: 6,342,619 N455S probably damaging Het
Olfr552 C A 7: 102,605,000 F215L probably benign Het
Pde4a T C 9: 21,206,238 F599L probably benign Het
Pga5 T C 19: 10,671,809 Y249C probably damaging Het
Plekha8 A T 6: 54,630,554 K382M probably damaging Het
Plekhd1 A T 12: 80,706,375 E119V probably damaging Het
Pnp A T 14: 50,947,899 H20L probably benign Het
Polq A T 16: 37,017,197 probably null Het
Psma3 T G 12: 70,988,476 I177R probably damaging Het
Ptpn3 A G 4: 57,240,784 probably null Het
Ptprt A T 2: 161,558,886 L1077Q probably damaging Het
Ralgps2 A T 1: 156,824,174 probably null Het
Rbm47 A T 5: 66,027,230 M10K possibly damaging Het
Rere A G 4: 150,619,196 D186G probably damaging Het
Rpl24 T C 16: 55,967,090 S38P probably damaging Het
Slco1a1 A T 6: 141,940,061 F79L possibly damaging Het
Sorl1 T A 9: 41,991,745 D1551V probably benign Het
Sos1 C A 17: 80,434,119 M412I probably benign Het
Spast G A 17: 74,359,298 V209I probably benign Het
Spindoc G T 19: 7,358,404 Q340K possibly damaging Het
Tlr6 T C 5: 64,953,842 Y574C probably damaging Het
Tnrc6a A G 7: 123,192,123 N1748S possibly damaging Het
Trbv13-2 A T 6: 41,121,540 K16N probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Usp24 A G 4: 106,368,736 D659G possibly damaging Het
Vmn2r88 T A 14: 51,418,796 C821S probably damaging Het
Whamm T A 7: 81,574,547 V197D probably damaging Het
Zfp777 A G 6: 48,029,167 F431S probably damaging Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69319373 missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69310027 missense possibly damaging 0.90
groats UTSW 11 69309491 nonsense probably null
BB005:Cntrob UTSW 11 69300295 missense probably damaging 0.97
BB015:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R0270:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69322868 missense probably damaging 1.00
R1749:Cntrob UTSW 11 69322874 missense probably damaging 0.99
R1775:Cntrob UTSW 11 69320867 missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69308054 missense probably benign 0.27
R1967:Cntrob UTSW 11 69320963 missense probably damaging 0.97
R2495:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R3121:Cntrob UTSW 11 69322700 nonsense probably null
R3780:Cntrob UTSW 11 69302882 missense probably damaging 0.97
R4449:Cntrob UTSW 11 69305549 missense probably benign 0.29
R4696:Cntrob UTSW 11 69320888 missense probably damaging 1.00
R4841:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69320906 missense probably damaging 0.97
R4982:Cntrob UTSW 11 69311362 splice site probably null
R5168:Cntrob UTSW 11 69299990 missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69321891 missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69314750 missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69322753 missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69309375 missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69311422 missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R6964:Cntrob UTSW 11 69309491 nonsense probably null
R7020:Cntrob UTSW 11 69303092 critical splice donor site probably null
R7425:Cntrob UTSW 11 69314734 nonsense probably null
R7928:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R7946:Cntrob UTSW 11 69315221 missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69299853 missense unknown
R8539:Cntrob UTSW 11 69320826 missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69320839 missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69302915 missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69314853 missense probably benign 0.00
R9626:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69322956 missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69321407 missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69311449 missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69305578 missense probably benign
Z1186:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1187:Cntrob UTSW 11 69305578 missense probably benign
Z1187:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1188:Cntrob UTSW 11 69305578 missense probably benign
Z1188:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1189:Cntrob UTSW 11 69305578 missense probably benign
Z1189:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1190:Cntrob UTSW 11 69305578 missense probably benign
Z1190:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1191:Cntrob UTSW 11 69305578 missense probably benign
Z1191:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1192:Cntrob UTSW 11 69305578 missense probably benign
Z1192:Cntrob UTSW 11 69308056 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTAGGGCCACTCAGACATCTAG -3'
(R):5'- GAACTTGCTAGCATCCCCAC -3'

Sequencing Primer
(F):5'- TAGTCACACACCAGCCTCAAAGG -3'
(R):5'- GAGCCTCTCCGTACACCATG -3'
Posted On 2020-10-20