Incidental Mutation 'R0380:Wdfy3'
ID65462
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission 038586-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R0380 (G1)
Quality Score108
Status Validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101948966 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 322 (Q322R)
Ref Sequence ENSEMBL: ENSMUSP00000134244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053177
AA Change: Q322R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: Q322R

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174598
AA Change: Q322R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: Q322R

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174698
AA Change: Q322R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: Q322R

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212024
AA Change: Q322R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,588,500 probably null Het
Abca14 A T 7: 120,278,480 I1073L probably benign Het
Adamts17 C T 7: 67,150,044 P1116L probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Ano4 A G 10: 88,978,813 I671T possibly damaging Het
Ap1g1 A G 8: 109,803,164 probably benign Het
Arhgap19 A G 19: 41,773,137 probably benign Het
Arhgap32 C T 9: 32,246,477 R129W probably damaging Het
Atp10b G T 11: 43,225,597 A924S probably damaging Het
Ccdc180 T A 4: 45,930,197 probably null Het
Cckbr A G 7: 105,434,991 T311A probably benign Het
Cr2 C T 1: 195,157,407 G947R probably damaging Het
Cyp2g1 T A 7: 26,814,295 probably benign Het
Dennd1c G A 17: 57,073,822 A210V probably damaging Het
Doxl2 A G 6: 48,975,839 I233V probably benign Het
Dscam A G 16: 97,056,610 Y67H probably damaging Het
Dsg2 T A 18: 20,582,939 Y282* probably null Het
Epg5 T C 18: 77,960,841 L688P probably damaging Het
Esr2 T G 12: 76,123,291 E458A possibly damaging Het
Fat1 T C 8: 45,010,123 S1326P probably damaging Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gpr12 T A 5: 146,583,336 T259S probably damaging Het
Grm5 T A 7: 88,074,376 C625S possibly damaging Het
H2-Q1 C T 17: 35,323,078 H209Y probably damaging Het
Hcfc2 C A 10: 82,728,438 probably benign Het
Itgal C A 7: 127,310,751 Y495* probably null Het
Kbtbd3 T A 9: 4,330,545 Y306* probably null Het
Kcns2 T C 15: 34,839,172 F227S possibly damaging Het
Kif1a T A 1: 93,056,031 probably null Het
Maml2 C T 9: 13,621,100 R537* probably null Het
Muc4 G A 16: 32,752,905 A928T probably benign Het
Nav3 A G 10: 109,758,879 probably benign Het
Neb A T 2: 52,232,202 M605K probably damaging Het
Olfr15 A T 16: 3,838,985 D4V probably benign Het
Pcdhb3 T G 18: 37,302,157 I392S possibly damaging Het
Prune2 A G 19: 17,124,007 T2292A probably damaging Het
Rbbp8nl A T 2: 180,281,719 M108K probably damaging Het
Rbm25 A G 12: 83,660,356 T259A probably benign Het
Recql C A 6: 142,369,430 R243L probably damaging Het
Rsf1 TGGCG TGGCGACGGCGGCG 7: 97,579,905 probably benign Het
Serpinb12 T C 1: 106,950,821 probably null Het
Slc16a14 T A 1: 84,929,530 I8F possibly damaging Het
Spef1 G T 2: 131,172,412 probably benign Het
Tas2r103 A G 6: 133,036,203 L300P probably damaging Het
Tas2r117 A T 6: 132,803,588 R230* probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Thnsl2 A T 6: 71,141,330 L38Q probably damaging Het
Tmem171 G T 13: 98,692,027 T205K possibly damaging Het
Tmem232 A T 17: 65,256,448 L650Q probably benign Het
Tpr T A 1: 150,412,947 D518E probably benign Het
Tsen54 T C 11: 115,822,597 V442A probably damaging Het
Tshz3 A T 7: 36,771,300 I905F probably damaging Het
Vmn1r66 C T 7: 10,274,743 C121Y probably benign Het
Wdr64 T C 1: 175,769,642 probably benign Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6298:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCTGAGGTACTGCAAATC -3'
(R):5'- TGTGGCACACAGCTCTCAGAAC -3'

Sequencing Primer
(F):5'- TACTGCAAATCCGGGCAAG -3'
(R):5'- GACAGAACTTCAATGCTGTGC -3'
Posted On2013-08-08