Incidental Mutation 'R8449:Olfr1258'
ID654648
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R8449 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89930534 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 242 (I242L)
Ref Sequence ENSEMBL: ENSMUSP00000099669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102609
AA Change: I242L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111516
AA Change: I242L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213720
AA Change: I242L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Fam47e C A 5: 92,555,131 R21S probably benign Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Gtf3c3 C T 1: 54,428,909 E190K probably damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Hrg T A 16: 22,961,536 S521R unknown Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Shisa6 G C 11: 66,525,730 Q79E probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Wnt5a A G 14: 28,513,151 M51V probably benign Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Zfp949 G T 9: 88,567,249 V36L possibly damaging Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1833:Olfr1258 UTSW 2 89930301 nonsense probably null
R1846:Olfr1258 UTSW 2 89930666 missense possibly damaging 0.45
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R5430:Olfr1258 UTSW 2 89929913 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
R7552:Olfr1258 UTSW 2 89930720 missense probably benign 0.06
R7709:Olfr1258 UTSW 2 89929881 missense probably benign 0.00
R8060:Olfr1258 UTSW 2 89930349 missense probably benign 0.04
R8349:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
Z1177:Olfr1258 UTSW 2 89930598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGCACTGATACCCACATTC -3'
(R):5'- TGCTGGCTTCAAATACAATGTC -3'

Sequencing Primer
(F):5'- CCACATTCTGGGGCTCTTTG -3'
(R):5'- TCCATCTACACAATTTCTTAATGGC -3'
Posted On2020-10-20