Incidental Mutation 'R8449:Fam47e'
ID654654
Institutional Source Beutler Lab
Gene Symbol Fam47e
Ensembl Gene ENSMUSG00000057068
Gene Namefamily with sequence similarity 47, member E
SynonymsGm1381, LOC384198
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8449 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92555069-92591279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92555131 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 21 (R21S)
Ref Sequence ENSEMBL: ENSMUSP00000115229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146417]
Predicted Effect probably benign
Transcript: ENSMUST00000146417
AA Change: R21S

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115229
Gene: ENSMUSG00000057068
AA Change: R21S

DomainStartEndE-ValueType
Pfam:FAM47 17 191 1.7e-31 PFAM
low complexity region 339 353 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace3 A G 11: 105,994,942 E58G probably damaging Het
Ank1 T A 8: 23,139,286 F4I possibly damaging Het
Arih2 T C 9: 108,611,673 D282G possibly damaging Het
Atp7b C T 8: 22,013,540 V733I probably damaging Het
Avil A G 10: 127,009,992 D370G probably benign Het
Ccdc88b T C 19: 6,855,845 E278G probably damaging Het
Cdkl3 A G 11: 52,084,433 H74R Het
Clec9a C A 6: 129,410,329 A49E probably damaging Het
Cntn5 A G 9: 9,666,835 probably null Het
Cyp11b2 A G 15: 74,851,579 M412T possibly damaging Het
Dync1i1 A G 6: 5,966,815 Q399R possibly damaging Het
Gimap4 A G 6: 48,690,760 I150V probably damaging Het
Gm4756 T C 12: 72,612,566 N145D probably damaging Het
Gm7361 T A 5: 26,260,389 M128K possibly damaging Het
Gtf3c3 C T 1: 54,428,909 E190K probably damaging Het
Hells T C 19: 38,951,842 S396P probably damaging Het
Hrg T A 16: 22,961,536 S521R unknown Het
Itih5 A G 2: 10,186,989 T112A probably benign Het
Ly9 T A 1: 171,594,018 N555I probably damaging Het
Morc2b C T 17: 33,136,801 E666K probably benign Het
Mup8 C A 4: 60,222,382 V30L probably benign Het
Nebl T A 2: 17,413,782 E268D probably damaging Het
Nr4a3 G T 4: 48,052,170 R308L probably benign Het
Olfr1080 T G 2: 86,553,636 I163L probably benign Het
Olfr125 A G 17: 37,835,670 R224G probably damaging Het
Olfr1258 A T 2: 89,930,534 I242L possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Olfr370 A T 8: 83,541,672 H176L probably damaging Het
Plcd3 A G 11: 103,074,670 Y530H probably damaging Het
Pou2af1 A T 9: 51,233,026 E80V probably damaging Het
Scgb2b18 C T 7: 33,173,231 D50N probably benign Het
Shisa6 G C 11: 66,525,730 Q79E probably benign Het
Sis C T 3: 72,903,651 G1679D probably damaging Het
Sorcs2 A T 5: 36,229,175 M173K possibly damaging Het
Ston2 T C 12: 91,641,875 D817G probably damaging Het
Ticrr T A 7: 79,694,680 F1431Y probably benign Het
Uevld T A 7: 46,945,307 N179I probably damaging Het
Utp6 G T 11: 79,945,784 Q375K probably benign Het
Vmn2r68 T A 7: 85,233,577 E322D probably damaging Het
Wnt5a A G 14: 28,513,151 M51V probably benign Het
Zfp202 A T 9: 40,207,680 R130* probably null Het
Zfp949 G T 9: 88,567,249 V36L possibly damaging Het
Other mutations in Fam47e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Fam47e APN 5 92579663 missense probably damaging 1.00
R0646:Fam47e UTSW 5 92578458 intron probably benign
R1170:Fam47e UTSW 5 92565922 splice site probably benign
R1216:Fam47e UTSW 5 92562484 missense probably damaging 0.99
R1926:Fam47e UTSW 5 92585385 missense possibly damaging 0.61
R3434:Fam47e UTSW 5 92585362 missense probably damaging 0.99
R3435:Fam47e UTSW 5 92585362 missense probably damaging 0.99
R4899:Fam47e UTSW 5 92574669 missense probably benign 0.23
R4925:Fam47e UTSW 5 92585290 missense probably damaging 1.00
R5885:Fam47e UTSW 5 92565968 missense probably damaging 0.97
R6060:Fam47e UTSW 5 92579613 missense possibly damaging 0.88
R6278:Fam47e UTSW 5 92562517 missense probably damaging 1.00
R6964:Fam47e UTSW 5 92566052 missense probably damaging 1.00
R7661:Fam47e UTSW 5 92587525 missense probably damaging 0.97
R7992:Fam47e UTSW 5 92574682 missense probably damaging 1.00
R8349:Fam47e UTSW 5 92555131 missense probably benign 0.27
Z1176:Fam47e UTSW 5 92579668 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGCCAGTTTTATACCTCCAG -3'
(R):5'- CTGGAAAGGCTGTGTTGCTC -3'

Sequencing Primer
(F):5'- CCAGCTATAGATTGTCAGTCTAGTC -3'
(R):5'- AAAGGCTGTGTTGCTCCAGATTG -3'
Posted On2020-10-20