Incidental Mutation 'R8450:Cry2'
ID 654692
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Name cryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.752) question?
Stock # R8450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 92403646-92434043 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 92413941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 296 (R296G)
Ref Sequence ENSEMBL: ENSMUSP00000088047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
AlphaFold Q9R194
PDB Structure A vertebrate cryptochrome [X-RAY DIFFRACTION]
a vertebrate cryptochrome with FAD [X-RAY DIFFRACTION]
A ubiquitin ligase-substrate complex [X-RAY DIFFRACTION]
Mammalian cryptochrome in complex with a small molecule competitor of its ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of Mammalian Period-Cryptochrome Complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000090559
AA Change: R296G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: R296G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111278
AA Change: R296G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: R296G

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Adgrv1 T A 13: 81,435,843 probably null Het
Arhgef2 G A 3: 88,646,220 R886H probably damaging Het
Armc12 T A 17: 28,532,057 D82E probably damaging Het
Atg2a T C 19: 6,246,811 S382P probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Cep170 A G 1: 176,736,879 L271S Het
Cers3 T C 7: 66,764,342 F92S possibly damaging Het
Chmp4c A T 3: 10,385,686 M109L possibly damaging Het
Cnmd T A 14: 79,645,381 K202* probably null Het
Cnp T C 11: 100,576,441 I70T probably damaging Het
Col27a1 C A 4: 63,329,897 T1721K unknown Het
Crtac1 G A 19: 42,309,186 R242W probably damaging Het
Cyp2t4 A G 7: 27,157,381 D282G possibly damaging Het
Dip2a G T 10: 76,264,856 T1495N probably damaging Het
Dmbt1 T C 7: 131,085,417 probably null Het
Dmp1 A T 5: 104,212,899 K480N probably damaging Het
Dnah17 A G 11: 118,087,047 S1820P probably damaging Het
Dnah6 A G 6: 73,195,815 V220A probably benign Het
Epha3 T C 16: 63,652,490 D344G possibly damaging Het
Esyt2 C A 12: 116,363,482 Q557K probably damaging Het
Fam72a A T 1: 131,533,925 D116V probably damaging Het
Fam81a T C 9: 70,125,018 N64S probably damaging Het
Fat3 T A 9: 15,915,139 T358S Het
Frat2 A T 19: 41,847,784 I43N probably damaging Het
Fryl A T 5: 73,068,730 D1863E probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 A T 5: 105,274,707 probably null Het
Gm8994 C T 6: 136,329,243 T234I possibly damaging Het
Grid2ip A G 5: 143,377,518 Y422C probably damaging Het
Hap1 T G 11: 100,349,281 D563A probably damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Hs3st3b1 G C 11: 63,889,564 P246A probably benign Het
Hsd17b4 T G 18: 50,164,667 L341R probably benign Het
Kbtbd11 G A 8: 15,028,603 V401M probably damaging Het
Lss T A 10: 76,535,595 L120Q probably damaging Het
Mdc1 T G 17: 35,848,299 S524A probably benign Het
Myoz3 T C 18: 60,579,002 Y168C probably damaging Het
Nceh1 C A 3: 27,239,664 D190E probably damaging Het
Neb T C 2: 52,206,182 R5039G probably benign Het
Nup50 T A 15: 84,935,275 V250E probably benign Het
Pcnx3 T A 19: 5,673,226 N1314Y probably damaging Het
Pdzk1 A G 3: 96,851,708 N143S probably benign Het
Rnf223 T G 4: 156,132,663 L165R probably damaging Het
Sbf1 A T 15: 89,299,509 F1267Y probably damaging Het
Scrn3 T G 2: 73,329,769 I252R possibly damaging Het
Sdr39u1 T C 14: 55,897,906 I193M probably damaging Het
Sh2d7 A G 9: 54,540,907 R71G probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Syk T C 13: 52,620,899 L225P probably damaging Het
Tbx1 A T 16: 18,582,045 V463E unknown Het
Tmem67 C T 4: 12,087,891 R19H probably benign Het
Ttn T A 2: 76,778,764 I17666F possibly damaging Het
Vcpip1 A G 1: 9,724,606 V1180A probably benign Het
Vps13a C T 19: 16,654,507 probably null Het
Wdr27 T C 17: 14,932,525 T107A probably benign Het
Zfp106 T C 2: 120,535,618 R58G Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
R8234:Cry2 UTSW 2 92412629 missense probably benign
R8350:Cry2 UTSW 2 92413941 missense probably benign 0.00
R8496:Cry2 UTSW 2 92426939 missense probably damaging 1.00
R9172:Cry2 UTSW 2 92413648 missense probably damaging 1.00
R9283:Cry2 UTSW 2 92413904 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATCCAAGGGAAGCCTGTC -3'
(R):5'- TGAAGCCATTCTTGGTGCC -3'

Sequencing Primer
(F):5'- GGAAGCCTGTCTTGCCCTC -3'
(R):5'- GCTGCATGTTGTACACTGAGAATC -3'
Posted On 2020-10-20