Incidental Mutation 'R8450:Fam81a'
ID654718
Institutional Source Beutler Lab
Gene Symbol Fam81a
Ensembl Gene ENSMUSG00000032224
Gene Namefamily with sequence similarity 81, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8450 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70088511-70142560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70125018 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 64 (N64S)
Ref Sequence ENSEMBL: ENSMUSP00000034749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034749] [ENSMUST00000123206] [ENSMUST00000141775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034749
AA Change: N64S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034749
Gene: ENSMUSG00000032224
AA Change: N64S

DomainStartEndE-ValueType
coiled coil region 75 106 N/A INTRINSIC
coiled coil region 158 187 N/A INTRINSIC
low complexity region 349 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123206
AA Change: N64S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000141775
AA Change: N64S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
Adgrv1 T A 13: 81,435,843 probably null Het
Arhgef2 G A 3: 88,646,220 R886H probably damaging Het
Armc12 T A 17: 28,532,057 D82E probably damaging Het
Atg2a T C 19: 6,246,811 S382P probably benign Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Cep170 A G 1: 176,736,879 L271S Het
Cers3 T C 7: 66,764,342 F92S possibly damaging Het
Chmp4c A T 3: 10,385,686 M109L possibly damaging Het
Cnmd T A 14: 79,645,381 K202* probably null Het
Cnp T C 11: 100,576,441 I70T probably damaging Het
Col27a1 C A 4: 63,329,897 T1721K unknown Het
Crtac1 G A 19: 42,309,186 R242W probably damaging Het
Cry2 T C 2: 92,413,941 R296G probably benign Het
Cyp2t4 A G 7: 27,157,381 D282G possibly damaging Het
Dip2a G T 10: 76,264,856 T1495N probably damaging Het
Dmbt1 T C 7: 131,085,417 probably null Het
Dmp1 A T 5: 104,212,899 K480N probably damaging Het
Dnah17 A G 11: 118,087,047 S1820P probably damaging Het
Dnah6 A G 6: 73,195,815 V220A probably benign Het
Epha3 T C 16: 63,652,490 D344G possibly damaging Het
Esyt2 C A 12: 116,363,482 Q557K probably damaging Het
Fam72a A T 1: 131,533,925 D116V probably damaging Het
Fat3 T A 9: 15,915,139 T358S Het
Frat2 A T 19: 41,847,784 I43N probably damaging Het
Fryl A T 5: 73,068,730 D1863E probably benign Het
Gm29735 ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA 7: 142,156,529 probably benign Het
Gm43302 A T 5: 105,274,707 probably null Het
Gm8994 C T 6: 136,329,243 T234I possibly damaging Het
Grid2ip A G 5: 143,377,518 Y422C probably damaging Het
Hap1 T G 11: 100,349,281 D563A probably damaging Het
Hbb-bs T C 7: 103,826,744 D122G probably benign Het
Hs3st3b1 G C 11: 63,889,564 P246A probably benign Het
Hsd17b4 T G 18: 50,164,667 L341R probably benign Het
Kbtbd11 G A 8: 15,028,603 V401M probably damaging Het
Lss T A 10: 76,535,595 L120Q probably damaging Het
Mdc1 T G 17: 35,848,299 S524A probably benign Het
Myoz3 T C 18: 60,579,002 Y168C probably damaging Het
Nceh1 C A 3: 27,239,664 D190E probably damaging Het
Neb T C 2: 52,206,182 R5039G probably benign Het
Nup50 T A 15: 84,935,275 V250E probably benign Het
Pcnx3 T A 19: 5,673,226 N1314Y probably damaging Het
Pdzk1 A G 3: 96,851,708 N143S probably benign Het
Rnf223 T G 4: 156,132,663 L165R probably damaging Het
Sbf1 A T 15: 89,299,509 F1267Y probably damaging Het
Scrn3 T G 2: 73,329,769 I252R possibly damaging Het
Sdr39u1 T C 14: 55,897,906 I193M probably damaging Het
Sh2d7 A G 9: 54,540,907 R71G probably benign Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Syk T C 13: 52,620,899 L225P probably damaging Het
Tbx1 A T 16: 18,582,045 V463E unknown Het
Tmem67 C T 4: 12,087,891 R19H probably benign Het
Ttn T A 2: 76,778,764 I17666F possibly damaging Het
Vcpip1 A G 1: 9,724,606 V1180A probably benign Het
Vps13a C T 19: 16,654,507 probably null Het
Wdr27 T C 17: 14,932,525 T107A probably benign Het
Zfp106 T C 2: 120,535,618 R58G Het
Other mutations in Fam81a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Fam81a APN 9 70099152 nonsense probably null
IGL02010:Fam81a APN 9 70099137 missense probably benign 0.04
IGL02891:Fam81a APN 9 70110276 missense probably damaging 1.00
R0100:Fam81a UTSW 9 70102809 splice site probably benign
R0497:Fam81a UTSW 9 70096119 missense possibly damaging 0.47
R0621:Fam81a UTSW 9 70093647 missense probably benign 0.35
R1075:Fam81a UTSW 9 70110274 nonsense probably null
R1524:Fam81a UTSW 9 70125108 missense probably damaging 1.00
R4970:Fam81a UTSW 9 70093590 nonsense probably null
R5138:Fam81a UTSW 9 70099175 missense probably benign 0.01
R5209:Fam81a UTSW 9 70125160 missense probably benign 0.06
R6139:Fam81a UTSW 9 70102818 critical splice donor site probably null
R6378:Fam81a UTSW 9 70110346 missense probably damaging 1.00
R7145:Fam81a UTSW 9 70110278 missense probably damaging 1.00
R8030:Fam81a UTSW 9 70102909 missense probably benign 0.11
R8350:Fam81a UTSW 9 70125018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGCATACAGGACTGTG -3'
(R):5'- GCATCTTCCAACCATGTGACTC -3'

Sequencing Primer
(F):5'- TGACAGCTGGGACTCAGACTTG -3'
(R):5'- CTTCTGCAGGCGAGTGAAGAC -3'
Posted On2020-10-20