Incidental Mutation 'R0382:Rbm45'
ID65472
Institutional Source Beutler Lab
Gene Symbol Rbm45
Ensembl Gene ENSMUSG00000042369
Gene NameRNA binding motif protein 45
SynonymsG430095G15Rik, Drbp1, Drb1
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R0382 (G1)
Quality Score95
Status Validated
Chromosome2
Chromosomal Location76369984-76383768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76370211 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 28 (I28N)
Ref Sequence ENSEMBL: ENSMUSP00000040420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046389
AA Change: I28N

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040420
Gene: ENSMUSG00000042369
AA Change: I28N

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
RRM 27 102 2.08e-12 SMART
RRM 122 191 1.37e-12 SMART
RRM 249 320 2.27e-1 SMART
RRM 394 460 4.07e-6 SMART
Meta Mutation Damage Score 0.4834 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif (RRM)-type RNA-binding family of proteins. This protein exhibits preferential binding to poly(C) RNA. Initial cloning of this gene found that the rat ortholog was dynamically expressed in the developing rat brain. This protein has been localized to inclusion bodies in the brain and spinal cord of amyotrophic lateral sclerosis and Alzheimer's patients. A pseudogene has been identified on chromosome 8. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Rbm45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Rbm45 APN 2 76378707 missense probably damaging 1.00
IGL03335:Rbm45 APN 2 76376433 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R0008:Rbm45 UTSW 2 76378398 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1468:Rbm45 UTSW 2 76372115 missense probably damaging 1.00
R1533:Rbm45 UTSW 2 76372159 critical splice donor site probably null
R1942:Rbm45 UTSW 2 76375479 critical splice donor site probably null
R2046:Rbm45 UTSW 2 76375398 missense probably benign
R2912:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2913:Rbm45 UTSW 2 76375454 missense probably benign 0.05
R2929:Rbm45 UTSW 2 76378419 missense probably benign 0.00
R3418:Rbm45 UTSW 2 76379018 missense probably damaging 1.00
R3886:Rbm45 UTSW 2 76375424 missense probably benign
R3887:Rbm45 UTSW 2 76375424 missense probably benign
R3888:Rbm45 UTSW 2 76375424 missense probably benign
R4488:Rbm45 UTSW 2 76376396 missense probably damaging 0.99
R5369:Rbm45 UTSW 2 76370250 missense probably damaging 1.00
R5990:Rbm45 UTSW 2 76370412 missense probably benign 0.36
R6569:Rbm45 UTSW 2 76379072 missense probably damaging 1.00
R6806:Rbm45 UTSW 2 76380460 missense probably benign 0.19
R7022:Rbm45 UTSW 2 76376394 missense probably damaging 1.00
R7832:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
R7915:Rbm45 UTSW 2 76376453 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- AGATTGCTGAGTCCACCGTGGC -3'
(R):5'- TGTTCCCAGGGTAAGAGGCTCC -3'

Sequencing Primer
(F):5'- AAGCGGAGCTGCTTACC -3'
(R):5'- AGGCACTGTCCGTGCATC -3'
Posted On2013-08-08