Mutagenetix > Incidental Mutations

Incidental Mutation 'R0382:Ckm'

65474

Institutional Source

Beutler Lab

Gene Symbol

Ckm

Ensembl Gene

ENSMUSG00000030399

Gene Name

creatine kinase, muscle

Synonyms

M-CK, MCK, Ckmm

MMRRC Submission

038588-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R0382 (G1)

Quality Score

141

Status

Validated

Chromosome

Chromosomal Location

19404776-19422841 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 19421384 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 382 (*382Q)

Ref Sequence

ENSEMBL: ENSMUSP00000146972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003643] [ENSMUST00000085715] [ENSMUST00000208710] [ENSMUST00000209058]

Predicted Effect

probably null
Transcript: ENSMUST00000003643
AA Change: *313Q

SMART Domains

Protein: ENSMUSP00000003643
Gene: ENSMUSG00000030399
AA Change: *313Q

Domain	Start	End	E-Value	Type
Pfam:ATP-gua_PtransN	24	99	5.2e-38	PFAM
Pfam:ATP-gua_Ptrans	120	367	2.6e-97	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000047020

SMART Domains

Protein: ENSMUSP00000043987
Gene: ENSMUSG00000040705

Domain	Start	End	E-Value	Type
low complexity region	7	31	N/A	INTRINSIC
low complexity region	44	55	N/A	INTRINSIC
low complexity region	86	95	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000085715

SMART Domains

Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397

Domain	Start	End	E-Value	Type
S_TKc	59	310	1.4e-109	SMART
UBA	331	368	9.62e-8	SMART
low complexity region	391	408	N/A	INTRINSIC
low complexity region	463	474	N/A	INTRINSIC
low complexity region	540	553	N/A	INTRINSIC
low complexity region	580	586	N/A	INTRINSIC
low complexity region	672	690	N/A	INTRINSIC
Pfam:KA1	709	752	1.4e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208650

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208685

Predicted Effect

probably null
Transcript: ENSMUST00000208710
AA Change: *382Q

Predicted Effect

probably benign
Transcript: ENSMUST00000209058

Meta Mutation Damage Score

0.9468

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.1%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in function and energy utilization of both skeletal and cardiac muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aak1	A	T	6: 86,946,919	Q266L	probably benign	Het
Abca13	T	C	11: 9,636,650		probably benign	Het
Adap2	T	C	11: 80,178,385		probably benign	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Brinp1	T	C	4: 68,762,308	R662G	possibly damaging	Het
Celsr3	C	A	9: 108,829,218	P967T	probably damaging	Het
Ces1b	T	C	8: 93,076,052		probably benign	Het
Clec14a	A	G	12: 58,268,617	V73A	probably damaging	Het
Cmya5	A	T	13: 93,092,748	V1944E	probably benign	Het
Col6a6	T	A	9: 105,755,555	D1473V	probably damaging	Het
Cttnbp2	A	G	6: 18,435,343	M172T	probably benign	Het
Dcaf12	T	C	4: 41,302,672	N161S	probably damaging	Het
Dnah17	T	C	11: 118,128,996	Y75C	probably damaging	Het
Efcab7	T	C	4: 99,901,769	V388A	possibly damaging	Het
Fat3	A	G	9: 15,959,756	C3780R	probably damaging	Het
Fbxl14	T	C	6: 119,481,060	*401R	probably null	Het
Fbxo5	G	T	10: 5,801,176	Y270*	probably null	Het
Fnbp1l	A	T	3: 122,570,953		probably benign	Het
Fstl3	T	C	10: 79,777,307	S3P	probably benign	Het
Gpatch1	T	C	7: 35,301,655	D309G	probably damaging	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Klk6	A	G	7: 43,829,245	D192G	probably benign	Het
Lrp6	A	G	6: 134,467,668	S1080P	probably damaging	Het
Lztfl1	T	C	9: 123,707,906		probably null	Het
Mov10l1	A	G	15: 88,985,593	Y59C	possibly damaging	Het
Natd1	C	T	11: 60,906,913	R62H	probably damaging	Het
Obscn	T	C	11: 59,040,306	T5835A	probably damaging	Het
Olfr1052	A	G	2: 86,298,593	Y259C	probably damaging	Het
Olfr1183	A	T	2: 88,461,725	R147S	possibly damaging	Het
Olfr1354	T	A	10: 78,917,126	Y95*	probably null	Het
Olfr792	T	C	10: 129,541,014	I159T	probably benign	Het
P2rx2	T	A	5: 110,341,179	E289V	probably benign	Het
Patl1	T	A	19: 11,925,232		probably null	Het
Ptprf	A	G	4: 118,223,394		probably benign	Het
Qrfpr	C	T	3: 36,180,969	C253Y	possibly damaging	Het
Rad21l	A	T	2: 151,645,443	D540E	probably damaging	Het
Rbm45	T	A	2: 76,370,211	I28N	possibly damaging	Het
Rnf170	A	T	8: 26,125,899		probably benign	Het
Sgsm3	G	A	15: 81,008,314	W280*	probably null	Het
Slc9a9	A	T	9: 94,685,217	H113L	probably benign	Het
Slc9b2	G	T	3: 135,318,422	C78F	probably damaging	Het
Slfn10-ps	T	A	11: 83,029,534		noncoding transcript	Het
Slfn8	T	A	11: 83,004,556	I475F	probably damaging	Het
Stox2	A	G	8: 47,203,284		probably benign	Het
Strbp	A	T	2: 37,600,826	N472K	probably benign	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tmem39a	A	G	16: 38,591,398		probably benign	Het
Trpc4ap	A	G	2: 155,636,230	L664P	probably damaging	Het
Uap1	T	A	1: 170,161,482	M124L	probably benign	Het
Usp48	A	G	4: 137,621,218	N536S	probably benign	Het
Usp50	T	A	2: 126,777,928	I155F	probably damaging	Het
Utp4	T	C	8: 106,922,935	I672T	probably benign	Het
Vmn1r94	A	T	7: 20,167,653	M242K	possibly damaging	Het
Vmn2r45	T	G	7: 8,483,099	N397H	probably benign	Het
Vmn2r9	T	C	5: 108,847,597	Y395C	probably damaging	Het
Vps41	C	A	13: 18,827,727	H335N	probably benign	Het

Other mutations in Ckm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Ckm	APN	7	19416787	nonsense	probably null
IGL01486:Ckm	APN	7	19421231	missense	probably damaging	1.00
IGL03303:Ckm	APN	7	19414338	splice site	probably benign
R0505:Ckm	UTSW	7	19419452	nonsense	probably null
R2042:Ckm	UTSW	7	19414157	missense	possibly damaging	0.49
R2157:Ckm	UTSW	7	19421354	missense	probably benign	0.00
R4257:Ckm	UTSW	7	19421354	missense	probably benign	0.00
R4515:Ckm	UTSW	7	19420284	missense	probably damaging	1.00
R4663:Ckm	UTSW	7	19419494	missense	probably damaging	1.00
R5327:Ckm	UTSW	7	19420165	missense	probably damaging	1.00
R5788:Ckm	UTSW	7	19419447	missense	probably benign	0.08
R6995:Ckm	UTSW	7	19420231	missense	probably benign	0.03
R7212:Ckm	UTSW	7	19415053	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGAACAGCAACTTTCCGAGACG -3'
(R):5'- AGACGCATAAGAGGTAAGTCCCCG -3'

Sequencing Primer
(F):5'- ACGTTTGCACTTGGGCAC -3'
(R):5'- GGCCATCACGGACTTTTATTTAAGG -3'

Posted On

2013-08-08