Incidental Mutation 'R0382:Ckm'
ID65474
Institutional Source Beutler Lab
Gene Symbol Ckm
Ensembl Gene ENSMUSG00000030399
Gene Namecreatine kinase, muscle
SynonymsM-CK, MCK, Ckmm
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0382 (G1)
Quality Score141
Status Validated
Chromosome7
Chromosomal Location19404776-19422841 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 19421384 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 382 (*382Q)
Ref Sequence ENSEMBL: ENSMUSP00000146972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003643] [ENSMUST00000085715] [ENSMUST00000208710] [ENSMUST00000209058]
Predicted Effect probably null
Transcript: ENSMUST00000003643
AA Change: *313Q
SMART Domains Protein: ENSMUSP00000003643
Gene: ENSMUSG00000030399
AA Change: *313Q

DomainStartEndE-ValueType
Pfam:ATP-gua_PtransN 24 99 5.2e-38 PFAM
Pfam:ATP-gua_Ptrans 120 367 2.6e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000047020
SMART Domains Protein: ENSMUSP00000043987
Gene: ENSMUSG00000040705

DomainStartEndE-ValueType
low complexity region 7 31 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 86 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085715
SMART Domains Protein: ENSMUSP00000082862
Gene: ENSMUSG00000030397

DomainStartEndE-ValueType
S_TKc 59 310 1.4e-109 SMART
UBA 331 368 9.62e-8 SMART
low complexity region 391 408 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
low complexity region 580 586 N/A INTRINSIC
low complexity region 672 690 N/A INTRINSIC
Pfam:KA1 709 752 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208685
Predicted Effect probably null
Transcript: ENSMUST00000208710
AA Change: *382Q
Predicted Effect probably benign
Transcript: ENSMUST00000209058
Meta Mutation Damage Score 0.9468 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in function and energy utilization of both skeletal and cardiac muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Fstl3 T C 10: 79,777,307 S3P probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Ckm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ckm APN 7 19416787 nonsense probably null
IGL01486:Ckm APN 7 19421231 missense probably damaging 1.00
IGL03303:Ckm APN 7 19414338 splice site probably benign
R0505:Ckm UTSW 7 19419452 nonsense probably null
R2042:Ckm UTSW 7 19414157 missense possibly damaging 0.49
R2157:Ckm UTSW 7 19421354 missense probably benign 0.00
R4257:Ckm UTSW 7 19421354 missense probably benign 0.00
R4515:Ckm UTSW 7 19420284 missense probably damaging 1.00
R4663:Ckm UTSW 7 19419494 missense probably damaging 1.00
R5327:Ckm UTSW 7 19420165 missense probably damaging 1.00
R5788:Ckm UTSW 7 19419447 missense probably benign 0.08
R6995:Ckm UTSW 7 19420231 missense probably benign 0.03
R7212:Ckm UTSW 7 19415053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGAACAGCAACTTTCCGAGACG -3'
(R):5'- AGACGCATAAGAGGTAAGTCCCCG -3'

Sequencing Primer
(F):5'- ACGTTTGCACTTGGGCAC -3'
(R):5'- GGCCATCACGGACTTTTATTTAAGG -3'
Posted On2013-08-08