Incidental Mutation 'R8451:1700123K08Rik'
ID654757
Institutional Source Beutler Lab
Gene Symbol 1700123K08Rik
Ensembl Gene ENSMUSG00000029526
Gene NameRIKEN cDNA 1700123K08 gene
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_029693.2; MGI:1923908

Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8451 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138561840-138564712 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138562926 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 158 (T158M)
Ref Sequence ENSEMBL: ENSMUSP00000031501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031501]
Predicted Effect probably benign
Transcript: ENSMUST00000031501
AA Change: T158M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000031501
Gene: ENSMUSG00000029526
AA Change: T158M

DomainStartEndE-ValueType
SCOP:d1bkds_ 48 165 6e-22 SMART
Blast:RasGEFN 66 182 2e-57 BLAST
low complexity region 263 282 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (38/38)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130204L05Rik A T 3: 91,088,364 M77K probably benign Het
Acss3 T C 10: 107,049,404 H242R probably damaging Het
Ago2 G T 15: 73,130,890 D164E probably damaging Het
Arl2bp G A 8: 94,666,879 E6K unknown Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Ccdc18 A G 5: 108,155,797 E249G probably damaging Het
Cep162 G A 9: 87,192,850 Q1360* probably null Het
Cep350 T C 1: 155,872,034 I2047V probably damaging Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Fmo6 C T 1: 162,920,605 V297M probably damaging Het
Furin C T 7: 80,398,722 V17M probably benign Het
Gm8994 T A 6: 136,328,544 M1K probably null Het
Hs6st1 A G 1: 36,069,060 T135A probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klk1 A G 7: 44,228,986 E190G probably benign Het
Map3k21 T C 8: 125,944,733 L920P probably benign Het
Mecom T A 3: 29,985,370 H180L probably benign Het
Mras T C 9: 99,411,495 I31V probably damaging Het
Nrxn3 A G 12: 89,510,643 D532G probably damaging Het
Nufip2 A G 11: 77,692,355 N365S probably damaging Het
Olfr1317 A T 2: 112,142,061 M39L probably benign Het
Olfr1416 T C 1: 92,479,938 I228V probably benign Het
Olfr527 T C 7: 140,336,605 Y248H probably damaging Het
Pgbd1 A T 13: 21,423,380 S215T probably benign Het
Ptcd3 A G 6: 71,908,641 C34R probably benign Het
Samd4 A G 14: 47,101,431 D703G probably damaging Het
Scaper A T 9: 55,816,804 N623K possibly damaging Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Slc12a9 T C 5: 137,328,448 D249G probably benign Het
Slc3a1 A G 17: 85,028,496 N22S possibly damaging Het
Sugct A G 13: 17,252,558 L339P probably damaging Het
Tenm3 T C 8: 48,287,872 D1192G probably damaging Het
Tinagl1 T A 4: 130,167,583 D289V probably damaging Het
Tnrc6b C A 15: 80,923,490 P1548T probably damaging Het
Trmt1l A G 1: 151,448,288 K152E unknown Het
Vmn1r173 T A 7: 23,702,532 L64* probably null Het
Zcchc2 T A 1: 106,030,932 N1044K probably damaging Het
Zfp750 T C 11: 121,513,309 I247V probably benign Het
Other mutations in 1700123K08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:1700123K08Rik APN 5 138562489 missense probably benign 0.01
IGL02318:1700123K08Rik APN 5 138563576 missense probably damaging 1.00
IGL02451:1700123K08Rik APN 5 138563547 missense probably damaging 1.00
IGL03263:1700123K08Rik APN 5 138564237 missense probably damaging 0.98
P0016:1700123K08Rik UTSW 5 138562938 nonsense probably null
R0686:1700123K08Rik UTSW 5 138564537 missense possibly damaging 0.70
R2051:1700123K08Rik UTSW 5 138564185 missense probably damaging 1.00
R2055:1700123K08Rik UTSW 5 138562845 missense probably damaging 0.99
R2185:1700123K08Rik UTSW 5 138563567 missense probably damaging 1.00
R2761:1700123K08Rik UTSW 5 138564174 missense possibly damaging 0.72
R4233:1700123K08Rik UTSW 5 138564192 missense probably damaging 1.00
R5610:1700123K08Rik UTSW 5 138564141 critical splice donor site probably null
R7136:1700123K08Rik UTSW 5 138562348 missense probably damaging 0.98
R7365:1700123K08Rik UTSW 5 138562936 missense probably benign 0.34
R8130:1700123K08Rik UTSW 5 138563009 missense probably damaging 0.98
R8347:1700123K08Rik UTSW 5 138562891 missense probably benign 0.00
R8350:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8351:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8352:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8450:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8452:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
R8475:1700123K08Rik UTSW 5 138562926 missense probably benign 0.02
Z1176:1700123K08Rik UTSW 5 138563553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTGGAGAATACCCCGG -3'
(R):5'- ACCACTATGCTCATCTGCAGAC -3'

Sequencing Primer
(F):5'- TCTGGAGAATACCCCGGTGAAATC -3'
(R):5'- TATGCTCATCTGCAGACAGGCTG -3'
Posted On2020-10-20