Incidental Mutation 'R8451:Cep162'
ID654769
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8451 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 87192850 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1360 (Q1360*)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably null
Transcript: ENSMUST00000093802
AA Change: Q1360*
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: Q1360*

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
9130204L05Rik A T 3: 91,088,364 M77K probably benign Het
Acss3 T C 10: 107,049,404 H242R probably damaging Het
Ago2 G T 15: 73,130,890 D164E probably damaging Het
Arl2bp G A 8: 94,666,879 E6K unknown Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Ccdc18 A G 5: 108,155,797 E249G probably damaging Het
Cep350 T C 1: 155,872,034 I2047V probably damaging Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Fmo6 C T 1: 162,920,605 V297M probably damaging Het
Furin C T 7: 80,398,722 V17M probably benign Het
Gm8994 T A 6: 136,328,544 M1K probably null Het
Hs6st1 A G 1: 36,069,060 T135A probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klk1 A G 7: 44,228,986 E190G probably benign Het
Map3k21 T C 8: 125,944,733 L920P probably benign Het
Mecom T A 3: 29,985,370 H180L probably benign Het
Mras T C 9: 99,411,495 I31V probably damaging Het
Nrxn3 A G 12: 89,510,643 D532G probably damaging Het
Nufip2 A G 11: 77,692,355 N365S probably damaging Het
Olfr1317 A T 2: 112,142,061 M39L probably benign Het
Olfr1416 T C 1: 92,479,938 I228V probably benign Het
Olfr527 T C 7: 140,336,605 Y248H probably damaging Het
Pgbd1 A T 13: 21,423,380 S215T probably benign Het
Ptcd3 A G 6: 71,908,641 C34R probably benign Het
Samd4 A G 14: 47,101,431 D703G probably damaging Het
Scaper A T 9: 55,816,804 N623K possibly damaging Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Slc12a9 T C 5: 137,328,448 D249G probably benign Het
Slc3a1 A G 17: 85,028,496 N22S possibly damaging Het
Sugct A G 13: 17,252,558 L339P probably damaging Het
Tenm3 T C 8: 48,287,872 D1192G probably damaging Het
Tinagl1 T A 4: 130,167,583 D289V probably damaging Het
Tnrc6b C A 15: 80,923,490 P1548T probably damaging Het
Trmt1l A G 1: 151,448,288 K152E unknown Het
Vmn1r173 T A 7: 23,702,532 L64* probably null Het
Zcchc2 T A 1: 106,030,932 N1044K probably damaging Het
Zfp750 T C 11: 121,513,309 I247V probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACAGCAGCAGGTTTTCATC -3'
(R):5'- CATTAAGCTTCATGGTTGGTCTGAG -3'

Sequencing Primer
(F):5'- ATCTGTCTTACAATGTGGTCACTCAG -3'
(R):5'- GTCTGAGTCTTTCCCAAGAGGC -3'
Posted On2020-10-20